RchiOBHm_Chr4g0402941

Catalyzes xyloglucan endohydrolysis (XEH) and or endotransglycosylation (XET). Cleaves and religates xyloglucan polymers, an essential constituent of the primary cell wall, and thereby participates in cell wall construction of growing tissues

Basic Information

Type: gene
Biological Identity
rosa_chinensis
4
Physical Location & Seq
Reverse (-)
21919896 .. 21920210
315 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ37471

Sequence Viewer

Length: 315 bp
ATGCTTATCTATATATACCTACCAAGCTCTTCTGTTCTACTTCAACTCAGCCATTCTTCACCTTCTTCTCTTCATCAGTTCTTCAACGAATCCTCATTTCATACATTTAGCTACTTCATGGCTTCTTCCACTTCAGTAGTGTTGCTGATTATTCCTCTTCCTGTTAACTCTTTCATGGTTGCCTCTGCTGGTAACTTCAACCAAGACTTTAAGATTACATGGGGGGACGGTCGAGCCAAGATACTCAATGACGGTCAACTTCTTACTCTCTCGCTCGACAAAGCCTCTGGCTCTGGTTTTGAATCCAAAAAGTAA

Protein Analysis

104

Amino Acids

11.41

Weight (kDa)

6.81

Isoelectric Point (pI)

35.64

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0018830)

Species Orthologous Gene IDs
fragaria_vesca FvH4_4g09151
pyrus_communis pycom09g07180
rosa_chinensis RchiOBHm_Chr4g0402941
rosa_laevigata RLG00000009038
rosa_samantha Rh2BG503900 Rh4AG116400 Rh4CG123600 Rh4CG123800 Rh4CG185600

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcuI CTGAAG 1 cut(s) 117
AgsI TTSAA 4 cut(s) 44, 85, 199, 302
AluBI AGCT 2 cut(s) 27, 111
AluI AGCT 2 cut(s) 27, 111
AsuHPI GGTGA 1 cut(s) 51
BseMII CTCAG 1 cut(s) 61
Bsh1285I CGRYCG 1 cut(s) 232
BsiEI CGRYCG 1 cut(s) 232
BslFI GGGAC 1 cut(s) 239
BsmFI GGGAC 1 cut(s) 239
BspCNI CTCAG 1 cut(s) 60
BspQI GCTCTTC 1 cut(s) 34
Bst4CI ACNGT 2 cut(s) 230, 254
Bst6I CTCTTC 3 cut(s) 34, 75, 162
BstDEI CTNAG 1 cut(s) 47
BstMCI CGRYCG 1 cut(s) 232
CviAII CATG 3 cut(s) 118, 175, 219
CviJI RGCY 7 cut(s) 27, 51, 111, 122, 236, 284, 291
CviKI_1 RGCY 7 cut(s) 27, 51, 111, 122, 236, 284, 291
DdeI CTNAG 1 cut(s) 47
Eam1104I CTCTTC 3 cut(s) 34, 75, 162
EarI CTCTTC 3 cut(s) 34, 75, 162
Eco57I CTGAAG 1 cut(s) 117
FaeI CATG 3 cut(s) 121, 178, 222
FaiI YATR 7 cut(s) 12, 14, 16, 102, 119, 176, 220
FaqI GGGAC 1 cut(s) 239
FatI CATG 3 cut(s) 117, 174, 218
Hin1II CATG 3 cut(s) 121, 178, 222
HincII GTYRAC 2 cut(s) 166, 257
HindII GTYRAC 2 cut(s) 166, 257
HinfI GANTC 2 cut(s) 89, 302
HpaI GTTAAC 1 cut(s) 166
HphI GGTGA 1 cut(s) 51
Hpy166II GTNNAC 2 cut(s) 166, 257
Hpy8I GTNNAC 2 cut(s) 166, 257
HpyAV CCTTC 1 cut(s) 72
HpyCH4III ACNGT 2 cut(s) 230, 254
HpyF3I CTNAG 1 cut(s) 47
Hsp92II CATG 3 cut(s) 121, 178, 222
KspAI GTTAAC 1 cut(s) 166
LguI GCTCTTC 1 cut(s) 34
LpnPI CCDG 4 cut(s) 174, 174, 273, 279
MaeIII GTNAC 1 cut(s) 191
MboII GAAGA 7 cut(s) 21, 48, 57, 62, 73, 117, 149
MnlI CCTC 4 cut(s) 103, 165, 193, 295
MseI TTAA 2 cut(s) 165, 210
NlaIII CATG 3 cut(s) 121, 178, 222
PciSI GCTCTTC 1 cut(s) 34
PfeI GAWTC 2 cut(s) 89, 302
SapI GCTCTTC 1 cut(s) 34
SaqAI TTAA 2 cut(s) 165, 210
SetI ASST 4 cut(s) 21, 29, 64, 113
TaaI ACNGT 2 cut(s) 230, 254
TaqI TCGA 2 cut(s) 232, 276
TfiI GAWTC 2 cut(s) 89, 302
Tru1I TTAA 2 cut(s) 165, 210
Tru9I TTAA 2 cut(s) 165, 210
TspDTI ATGAA 4 cut(s) 62, 89, 106, 163
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.