RchiOBHm_Chr4g0409851

Polysaccharide biosynthesis protein

Basic Information

Type: gene
Biological Identity
rosa_chinensis
4
Physical Location & Seq
Forward (+)
33482354 .. 33482724
371 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ38082

Sequence Viewer

Length: 168 bp
ATGCTTTCTGGATTTGGTTATTGTTATTTTTGGGTTGATTTTGATGGAATCAAAGCTTCCTTTGGAAGTCCGCCGACTGTTTATGTTCTAAGGCATCAATGGGTCTATTCGTGTGAGAAGGCCAAGCAGGAGCTGGATTATAGTCCTAGTCACTTGAAGGAAGGATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
Pfam Domains
Protein Families

Protein Analysis

55

Amino Acids

6.37

Weight (kDa)

6.0

Isoelectric Point (pI)

39.67

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0012936)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 71
AgsI TTSAA 1 cut(s) 157
AluBI AGCT 2 cut(s) 56, 133
AluI AGCT 2 cut(s) 56, 133
AlwNI CAGNNNCTG 1 cut(s) 133
AoxI GGCC 1 cut(s) 120
BccI CCATC 1 cut(s) 38
BfaI CTAG 1 cut(s) 147
BmsI GCATC 1 cut(s) 103
BshFI GGCC 1 cut(s) 122
BsnI GGCC 1 cut(s) 122
BspACI CCGC 1 cut(s) 71
BspANI GGCC 1 cut(s) 122
Bst4CI ACNGT 1 cut(s) 79
BstDEI CTNAG 1 cut(s) 89
BsuRI GGCC 1 cut(s) 122
CaiI CAGNNNCTG 1 cut(s) 133
CviJI RGCY 3 cut(s) 56, 122, 133
CviKI_1 RGCY 3 cut(s) 56, 122, 133
DdeI CTNAG 1 cut(s) 89
EciI GGCGGA 1 cut(s) 60
FaiI YATR 2 cut(s) 84, 141
FspBI CTAG 1 cut(s) 147
HaeIII GGCC 1 cut(s) 122
HindIII AAGCTT 1 cut(s) 54
HinfI GANTC 1 cut(s) 48
Hpy188III TCNNGA 1 cut(s) 9
HpyAV CCTTC 3 cut(s) 112, 151, 155
HpyCH4III ACNGT 1 cut(s) 79
HpyF3I CTNAG 1 cut(s) 89
LmnI GCTCC 1 cut(s) 130
LpnPI CCDG 2 cut(s) 113, 119
LweI GCATC 1 cut(s) 103
MaeI CTAG 1 cut(s) 147
MaeIII GTNAC 1 cut(s) 149
NmuCI GTSAC 1 cut(s) 149
PfeI GAWTC 1 cut(s) 48
PstNI CAGNNNCTG 1 cut(s) 133
SetI ASST 2 cut(s) 58, 135
SfaNI GCATC 1 cut(s) 103
SgeI CNNG 6 cut(s) 21, 123, 136, 140, 146, 159
SsiI CCGC 1 cut(s) 71
SspMI CTAG 1 cut(s) 147
TaaI ACNGT 1 cut(s) 79
TfiI GAWTC 1 cut(s) 48
TseFI GTSAC 1 cut(s) 149
Tsp45I GTSAC 1 cut(s) 149
XcmI CCANNNNNNNNNTGG 1 cut(s) 130
XspI CTAG 1 cut(s) 147
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.