RchiOBHm_Chr5g0013111

Polysaccharide biosynthesis protein

Basic Information

Type: gene
Biological Identity
rosa_chinensis
5
Physical Location & Seq
Reverse (-)
8886192 .. 8887068
877 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ29365

Sequence Viewer

Length: 237 bp
ATGAACAGATTCAATTCTTACGAGCAGAATGCCATGACAGGCTTTGAGGGGATGAAGATGGTGGATTTAGTTGTGTGCCCTGGCTCAAGAATTTGGATGTTGATTCTCATCTCTCGAATTACAGGGAAGCTTTCTTTGATCAGTCCACCGACTGTTTATGTTTTAAGGCATCAATGGGCCTATTTGTGTGAGAAAGCCAAGCAGAAGTTGGATTATAGTCCTAGAAGCTTGACATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
Pfam Domains
Protein Families

Protein Analysis

78

Amino Acids

9.03

Weight (kDa)

9.56

Isoelectric Point (pI)

44.21

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0012936)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 90
AgsI TTSAA 1 cut(s) 13
AjnI CCWGG 1 cut(s) 79
AluBI AGCT 2 cut(s) 130, 228
AluI AGCT 2 cut(s) 130, 228
AoxI GGCC 1 cut(s) 177
ApoI RAATTY 1 cut(s) 90
Asp700I GAANNNNTTC 1 cut(s) 8
AspS9I GGNCC 1 cut(s) 177
BaeGI GKGCMC 1 cut(s) 80
BccI CCATC 1 cut(s) 52
BcgI CGANNNNNNTGC 2 cut(s) 11, 45
BciT130I CCWGG 1 cut(s) 81
BclI TGATCA 1 cut(s) 138
BfaI CTAG 1 cut(s) 222
Bme1390I CCNGG 1 cut(s) 81
BmgT120I GGNCC 1 cut(s) 177
BmrFI CCNGG 1 cut(s) 81
BmsI GCATC 1 cut(s) 178
BpuEI CTTGAG 1 cut(s) 70
BsaBI GATNNNNATC 1 cut(s) 107
BsaJI CCNNGG 1 cut(s) 79
Bse8I GATNNNNATC 1 cut(s) 107
BseBI CCWGG 1 cut(s) 81
BseDI CCNNGG 1 cut(s) 79
BseGI GGATG 2 cut(s) 57, 102
BseJI GATNNNNATC 1 cut(s) 107
BseSI GKGCMC 1 cut(s) 80
BshFI GGCC 1 cut(s) 179
BsmI GAATGC 1 cut(s) 34
BsnI GGCC 1 cut(s) 179
Bsp1286I GDGCHC 1 cut(s) 80
Bsp143I GATC 1 cut(s) 138
BspANI GGCC 1 cut(s) 179
BssECI CCNNGG 1 cut(s) 79
BssMI GATC 1 cut(s) 138
Bst2UI CCWGG 1 cut(s) 81
Bst4CI ACNGT 1 cut(s) 154
BstF5I GGATG 2 cut(s) 57, 102
BstKTI GATC 1 cut(s) 141
BstMBI GATC 1 cut(s) 138
BstNI CCWGG 1 cut(s) 81
BstSCI CCNGG 1 cut(s) 79
BstSLI GKGCMC 1 cut(s) 80
BsuRI GGCC 1 cut(s) 179
BtsCI GGATG 2 cut(s) 57, 102
Cfr13I GGNCC 1 cut(s) 177
CviAII CATG 1 cut(s) 34
CviJI RGCY 6 cut(s) 42, 84, 130, 179, 197, 228
CviKI_1 RGCY 6 cut(s) 42, 84, 130, 179, 197, 228
DpnI GATC 1 cut(s) 140
DpnII GATC 1 cut(s) 138
EcoRII CCWGG 1 cut(s) 79
FaeI CATG 1 cut(s) 37
FaiI YATR 4 cut(s) 35, 159, 216, 235
FatI CATG 1 cut(s) 33
FbaI TGATCA 1 cut(s) 138
FokI GGATG 2 cut(s) 64, 109
FspBI CTAG 1 cut(s) 222
HaeIII GGCC 1 cut(s) 179
Hin1II CATG 1 cut(s) 37
HindIII AAGCTT 2 cut(s) 128, 226
HinfI GANTC 2 cut(s) 9, 103
Hpy166II GTNNAC 1 cut(s) 146
Hpy188III TCNNGA 2 cut(s) 87, 114
Hpy8I GTNNAC 1 cut(s) 146
HpyCH4III ACNGT 1 cut(s) 154
Hsp92II CATG 1 cut(s) 37
Ksp22I TGATCA 1 cut(s) 138
Kzo9I GATC 1 cut(s) 138
LpnPI CCDG 4 cut(s) 24, 66, 93, 108
LweI GCATC 1 cut(s) 178
MaeI CTAG 1 cut(s) 222
MalI GATC 1 cut(s) 140
MboI GATC 1 cut(s) 138
MboII GAAGA 1 cut(s) 67
MhlI GDGCHC 1 cut(s) 80
MluCI AATT 3 cut(s) 13, 90, 117
MmeI TCCRAC 1 cut(s) 189
MnlI CCTC 1 cut(s) 40
MroXI GAANNNNTTC 1 cut(s) 8
MseI TTAA 1 cut(s) 164
MspR9I CCNGG 1 cut(s) 81
Mva1269I GAATGC 1 cut(s) 34
MvaI CCWGG 1 cut(s) 81
NdeII GATC 1 cut(s) 138
NlaIII CATG 1 cut(s) 37
PctI GAATGC 1 cut(s) 34
PdmI GAANNNNTTC 1 cut(s) 8
PfeI GAWTC 2 cut(s) 9, 103
Psp6I CCWGG 1 cut(s) 79
PspGI CCWGG 1 cut(s) 79
PspPI GGNCC 1 cut(s) 177
SaqAI TTAA 1 cut(s) 164
Sau3AI GATC 1 cut(s) 138
Sau96I GGNCC 1 cut(s) 177
ScrFI CCNGG 1 cut(s) 81
SduI GDGCHC 1 cut(s) 80
SetI ASST 2 cut(s) 132, 230
SfaNI GCATC 1 cut(s) 178
SgeI CNNG 9 cut(s) 34, 46, 51, 92, 93, 99, 126, 135, 211
SmlI CTYRAG 1 cut(s) 85
SmoI CTYRAG 1 cut(s) 85
Sse9I AATT 3 cut(s) 13, 90, 117
SspMI CTAG 1 cut(s) 222
StyD4I CCNGG 1 cut(s) 79
TaaI ACNGT 1 cut(s) 154
TaqI TCGA 1 cut(s) 115
TasI AATT 3 cut(s) 13, 90, 117
TfiI GAWTC 2 cut(s) 9, 103
Tru1I TTAA 1 cut(s) 164
Tru9I TTAA 1 cut(s) 164
TspDTI ATGAA 2 cut(s) 17, 68
XapI RAATTY 1 cut(s) 90
XcmI CCANNNNNNNNNTGG 1 cut(s) 205
XmnI GAANNNNTTC 1 cut(s) 8
XspI CTAG 1 cut(s) 222
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.