RchiOBHm_Chr4g0416771

Clathrin assembly protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_chinensis
4
OG0016337
Physical Location & Seq
Reverse (-)
41945401 .. 41948715
3315 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ38689

Sequence Viewer

Length: 414 bp
ATGGACTATTGTACCTGCATTCATTTATATGCATCATATCTCGAAGAACGCCTGGACTGTTTTCGTGTCCTGAAGTACGATGTTCAGAAAGATCACTTGAGAACCAAGGAACTTGAAACCCCAGACTTACTAAGGCATCTTCCTGCTTTGCAACAGCTTCTTTCTCGCCTTCTTGATTGCCAGCCACAACTGGGAACTGTATGTAATAGCCTGATTCAGTATGCTATTTCAATGGTACAAACTCTCAAAAGCTCAATTGTAAGTAGGTCTAATTTGATACCATTCCATCCAATATTCCTTCTGATGTTCCTCCATCAGGTTGCAGGTAAAATTGCTAACTTGTATGTTGCAATTATAGATGGTATTGTCAATTTAGTTAACAACGCAGGCCTTGCTTTTCTATGTGCACAATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
ANTH

Protein Analysis

137

Amino Acids

15.58

Weight (kDa)

6.93

Isoelectric Point (pI)

35.65

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
ANTH PF07651 2 - 79 5.2e-13 ANTH domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 2 cut(s) 23, 314
AcuI CTGAAG 1 cut(s) 92
AfaI GTAC 3 cut(s) 13, 77, 237
AfiI CCNNNNNNNGG 2 cut(s) 191, 316
AgsI TTSAA 2 cut(s) 116, 231
AjnI CCWGG 1 cut(s) 51
AluBI AGCT 2 cut(s) 157, 252
AluI AGCT 2 cut(s) 157, 252
Alw21I GWGCWC 1 cut(s) 409
Alw44I GTGCAC 1 cut(s) 405
AoxI GGCC 1 cut(s) 388
ApaLI GTGCAC 1 cut(s) 405
BaeGI GKGCMC 1 cut(s) 409
BaeI ACNNNNGTAYC 1 cut(s) 28
Bbv12I GWGCWC 1 cut(s) 409
BccI CCATC 3 cut(s) 294, 321, 353
BciT130I CCWGG 1 cut(s) 53
BfuAI ACCTGC 2 cut(s) 23, 314
Bme1390I CCNGG 1 cut(s) 53
BmrFI CCNGG 1 cut(s) 53
BmrI ACTGGG 1 cut(s) 200
BmsI GCATC 2 cut(s) 41, 145
BmuI ACTGGG 1 cut(s) 200
BpuEI CTTGAG 1 cut(s) 118
BsaJI CCNNGG 1 cut(s) 105
Bsc4I CCNNNNNNNGG 2 cut(s) 191, 316
Bse1I ACTGG 1 cut(s) 195
BseBI CCWGG 1 cut(s) 53
BseDI CCNNGG 1 cut(s) 105
BseGI GGATG 1 cut(s) 286
BseLI CCNNNNNNNGG 2 cut(s) 191, 316
BseNI ACTGG 1 cut(s) 195
BseSI GKGCMC 1 cut(s) 409
BshFI GGCC 1 cut(s) 390
BsiHKAI GWGCWC 1 cut(s) 409
BslI CCNNNNNNNGG 2 cut(s) 191, 316
BsmI GAATGC 1 cut(s) 18
BsnI GGCC 1 cut(s) 390
Bsp1286I GDGCHC 1 cut(s) 409
Bsp143I GATC 1 cut(s) 91
BspANI GGCC 1 cut(s) 390
BspMI ACCTGC 2 cut(s) 23, 314
BsrI ACTGG 1 cut(s) 195
BssECI CCNNGG 1 cut(s) 105
BssMI GATC 1 cut(s) 91
BssT1I CCWWGG 1 cut(s) 105
Bst2UI CCWGG 1 cut(s) 53
Bst4CI ACNGT 2 cut(s) 59, 199
BstAPI GCANNNNNTGC 1 cut(s) 392
BstC8I GCNNGC 2 cut(s) 182, 388
BstDEI CTNAG 1 cut(s) 131
BstENI CCTNNNNNAGG 1 cut(s) 314
BstF5I GGATG 1 cut(s) 286
BstKTI GATC 1 cut(s) 94
BstMBI GATC 1 cut(s) 91
BstMWI GCNNNNNNNGC 1 cut(s) 392
BstNI CCWGG 1 cut(s) 53
BstSCI CCNGG 1 cut(s) 51
BstSLI GKGCMC 1 cut(s) 409
BsuRI GGCC 1 cut(s) 390
BtsCI GGATG 1 cut(s) 286
BveI ACCTGC 2 cut(s) 23, 314
Cac8I GCNNGC 2 cut(s) 182, 388
Csp6I GTAC 3 cut(s) 12, 76, 236
CviJI RGCY 5 cut(s) 157, 184, 210, 252, 390
CviKI_1 RGCY 5 cut(s) 157, 184, 210, 252, 390
CviQI GTAC 3 cut(s) 12, 76, 236
DdeI CTNAG 1 cut(s) 131
DpnI GATC 1 cut(s) 93
DpnII GATC 1 cut(s) 91
Eco130I CCWWGG 1 cut(s) 105
Eco147I AGGCCT 1 cut(s) 390
Eco57I CTGAAG 1 cut(s) 92
EcoNI CCTNNNNNAGG 1 cut(s) 314
EcoRII CCWGG 1 cut(s) 51
EcoT14I CCWWGG 1 cut(s) 105
EcoT22I ATGCAT 1 cut(s) 34
ErhI CCWWGG 1 cut(s) 105
FaiI YATR 8 cut(s) 28, 30, 37, 202, 222, 345, 356, 403
FokI GGATG 1 cut(s) 273
HaeIII GGCC 1 cut(s) 390
HincII GTYRAC 1 cut(s) 379
HindII GTYRAC 1 cut(s) 379
HinfI GANTC 1 cut(s) 214
HpaI GTTAAC 1 cut(s) 379
Hpy166II GTNNAC 2 cut(s) 379, 407
Hpy188I TCNGA 2 cut(s) 87, 303
Hpy188III TCNNGA 3 cut(s) 41, 70, 173
Hpy8I GTNNAC 2 cut(s) 379, 407
HpyAV CCTTC 2 cut(s) 179, 308
HpyCH4III ACNGT 2 cut(s) 59, 199
HpyCH4V TGCA 6 cut(s) 18, 32, 151, 323, 350, 407
HpyF10VI GCNNNNNNNGC 1 cut(s) 392
HpyF3I CTNAG 1 cut(s) 131
KspAI GTTAAC 1 cut(s) 379
Kzo9I GATC 1 cut(s) 91
LweI GCATC 2 cut(s) 41, 145
MalI GATC 1 cut(s) 93
MboI GATC 1 cut(s) 91
MboII GAAGA 2 cut(s) 56, 131
MfeI CAATTG 1 cut(s) 255
MhlI GDGCHC 1 cut(s) 409
MluCI AATT 5 cut(s) 255, 271, 330, 351, 370
MnlI CCTC 1 cut(s) 320
Mph1103I ATGCAT 1 cut(s) 34
MseI TTAA 1 cut(s) 378
MslI CAYNNNNRTG 1 cut(s) 27
MspR9I CCNGG 1 cut(s) 53
MunI CAATTG 1 cut(s) 255
Mva1269I GAATGC 1 cut(s) 18
MvaI CCWGG 1 cut(s) 53
MwoI GCNNNNNNNGC 1 cut(s) 392
NdeII GATC 1 cut(s) 91
NsiI ATGCAT 1 cut(s) 34
PceI AGGCCT 1 cut(s) 390
PctI GAATGC 1 cut(s) 18
PfeI GAWTC 1 cut(s) 214
Psp6I CCWGG 1 cut(s) 51
PspGI CCWGG 1 cut(s) 51
RsaI GTAC 3 cut(s) 13, 77, 237
RsaNI GTAC 3 cut(s) 12, 76, 236
RseI CAYNNNNRTG 1 cut(s) 27
SaqAI TTAA 1 cut(s) 378
Sau3AI GATC 1 cut(s) 91
ScrFI CCNGG 1 cut(s) 53
SduI GDGCHC 1 cut(s) 409
SetI ASST 6 cut(s) 17, 159, 254, 269, 321, 328
SfaNI GCATC 2 cut(s) 41, 145
SmiMI CAYNNNNRTG 1 cut(s) 27
SmlI CTYRAG 1 cut(s) 97
SmoI CTYRAG 1 cut(s) 97
Sse9I AATT 5 cut(s) 255, 271, 330, 351, 370
SseBI AGGCCT 1 cut(s) 390
SspI AATATT 1 cut(s) 294
StuI AGGCCT 1 cut(s) 390
StyD4I CCNGG 1 cut(s) 51
StyI CCWWGG 1 cut(s) 105
TaaI ACNGT 2 cut(s) 59, 199
TaqI TCGA 1 cut(s) 42
TasI AATT 5 cut(s) 255, 271, 330, 351, 370
TfiI GAWTC 1 cut(s) 214
Tru1I TTAA 1 cut(s) 378
Tru9I TTAA 1 cut(s) 378
TspDTI ATGAA 1 cut(s) 11
VneI GTGCAC 1 cut(s) 405
XagI CCTNNNNNAGG 1 cut(s) 314
Zsp2I ATGCAT 1 cut(s) 34
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.