Rroxscaffold_7G00189790

Clathrin assembly protein

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000007
Physical Location & Seq
Reverse (-)
29629429 .. 29633936
4508 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_7G00189790.1

Sequence Viewer

Length: 198 bp
ATGATGGCATTTAGAATAAAGGATCTCACATGTTCAATACAATCTCTACAGAGAACCAAGGAACTTGAAACCCCAGACTTACCAAGGCATCTACCTGCTTTGCAACAGCTTCTTTCTCGCCTTCTTGATTACCAGCCACAACTGGGGACTATATGTAATAGCCTGATTCAATATGCTATTTCAATGGTTGCAGGTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

65

Amino Acids

7.37

Weight (kDa)

7.81

Isoelectric Point (pI)

49.35

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 2 cut(s) 103, 182
AclWI GGATC 1 cut(s) 30
AfiI CCNNNNNNNGG 1 cut(s) 143
AflIII ACRYGT 1 cut(s) 29
AgsI TTSAA 4 cut(s) 36, 68, 170, 183
AluBI AGCT 1 cut(s) 109
AluI AGCT 1 cut(s) 109
AlwI GGATC 1 cut(s) 30
BfmI CTRYAG 1 cut(s) 47
BfuAI ACCTGC 2 cut(s) 103, 182
BmrI ACTGGG 1 cut(s) 152
BmsI GCATC 1 cut(s) 97
BmuI ACTGGG 1 cut(s) 152
BsaJI CCNNGG 2 cut(s) 57, 83
Bsc4I CCNNNNNNNGG 1 cut(s) 143
Bse1I ACTGG 1 cut(s) 147
BseDI CCNNGG 2 cut(s) 57, 83
BseLI CCNNNNNNNGG 1 cut(s) 143
BseNI ACTGG 1 cut(s) 147
BslFI GGGAC 1 cut(s) 160
BslI CCNNNNNNNGG 1 cut(s) 143
BsmFI GGGAC 1 cut(s) 160
Bsp143I GATC 1 cut(s) 22
BspMI ACCTGC 2 cut(s) 103, 182
BspPI GGATC 1 cut(s) 30
BsrI ACTGG 1 cut(s) 147
BssECI CCNNGG 2 cut(s) 57, 83
BssMI GATC 1 cut(s) 22
BssT1I CCWWGG 2 cut(s) 57, 83
BstKTI GATC 1 cut(s) 25
BstMBI GATC 1 cut(s) 22
BstNSI RCATGY 1 cut(s) 33
BstSFI CTRYAG 1 cut(s) 47
BstX2I RGATCY 1 cut(s) 22
BstYI RGATCY 1 cut(s) 22
BveI ACCTGC 2 cut(s) 103, 182
CviAII CATG 1 cut(s) 30
CviJI RGCY 3 cut(s) 109, 136, 162
CviKI_1 RGCY 3 cut(s) 109, 136, 162
DpnI GATC 1 cut(s) 24
DpnII GATC 1 cut(s) 22
Eco130I CCWWGG 2 cut(s) 57, 83
EcoT14I CCWWGG 2 cut(s) 57, 83
ErhI CCWWGG 2 cut(s) 57, 83
FaeI CATG 1 cut(s) 33
FaiI YATR 4 cut(s) 31, 152, 154, 174
FaqI GGGAC 1 cut(s) 160
FatI CATG 1 cut(s) 29
Hin1II CATG 1 cut(s) 33
HinfI GANTC 1 cut(s) 166
Hpy188III TCNNGA 1 cut(s) 125
HpyAV CCTTC 1 cut(s) 131
HpyCH4V TGCA 2 cut(s) 103, 191
Hsp92II CATG 1 cut(s) 33
Kzo9I GATC 1 cut(s) 22
LpnPI CCDG 6 cut(s) 87, 108, 128, 146, 176, 177
LweI GCATC 1 cut(s) 97
MalI GATC 1 cut(s) 24
MboI GATC 1 cut(s) 22
MflI RGATCY 1 cut(s) 22
MseI TTAA 1 cut(s) 196
NdeII GATC 1 cut(s) 22
NlaIII CATG 1 cut(s) 33
NspI RCATGY 1 cut(s) 33
PciI ACATGT 1 cut(s) 29
PfeI GAWTC 1 cut(s) 166
PscI ACATGT 1 cut(s) 29
PsuI RGATCY 1 cut(s) 22
SaqAI TTAA 1 cut(s) 196
Sau3AI GATC 1 cut(s) 22
SetI ASST 3 cut(s) 97, 111, 196
SfaNI GCATC 1 cut(s) 97
SfcI CTRYAG 1 cut(s) 47
StyI CCWWGG 2 cut(s) 57, 83
TfiI GAWTC 1 cut(s) 166
Tru1I TTAA 1 cut(s) 196
Tru9I TTAA 1 cut(s) 196
XceI RCATGY 1 cut(s) 33
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.