RchiOBHm_Chr5g0055631

No description available

Basic Information

Type: gene
Biological Identity
rosa_chinensis
5
Physical Location & Seq
Reverse (-)
58939959 .. 58940533
575 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ33261

Sequence Viewer

Length: 126 bp
ATGACTGCATCTCTCTCTTCTTCATCCAAATCCACAATTTCAGAGCGAGAGAGATCTGAGCTAGGATTGGGTTCTGAAGTGCTTATTGGGATTTGGGTGGAAACAAGTTTGTCTTTATTGCTTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

41

Amino Acids

4.37

Weight (kDa)

4.65

Isoelectric Point (pI)

43.81

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcuI CTGAAG 1 cut(s) 96
AjuI GAANNNNNNNTTGG 2 cut(s) 69, 101
AluBI AGCT 1 cut(s) 61
AluI AGCT 1 cut(s) 61
BfaI CTAG 1 cut(s) 62
BglII AGATCT 1 cut(s) 53
BmsI GCATC 1 cut(s) 17
BseGI GGATG 1 cut(s) 23
BseMII CTCAG 1 cut(s) 48
Bsp143I GATC 1 cut(s) 53
BspCNI CTCAG 1 cut(s) 49
BssMI GATC 1 cut(s) 53
Bst6I CTCTTC 1 cut(s) 22
BstDEI CTNAG 1 cut(s) 57
BstF5I GGATG 1 cut(s) 23
BstKTI GATC 1 cut(s) 56
BstMBI GATC 1 cut(s) 53
BstX2I RGATCY 1 cut(s) 53
BstYI RGATCY 1 cut(s) 53
BtsCI GGATG 1 cut(s) 23
CviJI RGCY 1 cut(s) 61
CviKI_1 RGCY 1 cut(s) 61
DdeI CTNAG 1 cut(s) 57
DpnI GATC 1 cut(s) 55
DpnII GATC 1 cut(s) 53
Eam1104I CTCTTC 1 cut(s) 22
EarI CTCTTC 1 cut(s) 22
Eco57I CTGAAG 1 cut(s) 96
FalI AAGNNNNNCTT 1 cut(s) 97
FokI GGATG 1 cut(s) 10
FspBI CTAG 1 cut(s) 62
Hpy188I TCNGA 3 cut(s) 43, 58, 76
HpyCH4V TGCA 1 cut(s) 8
HpyF3I CTNAG 1 cut(s) 57
Kzo9I GATC 1 cut(s) 53
LweI GCATC 1 cut(s) 17
MaeI CTAG 1 cut(s) 62
MalI GATC 1 cut(s) 55
MboI GATC 1 cut(s) 53
MboII GAAGA 2 cut(s) 9, 12
MflI RGATCY 1 cut(s) 53
MluCI AATT 1 cut(s) 36
NdeII GATC 1 cut(s) 53
PsuI RGATCY 1 cut(s) 53
Sau3AI GATC 1 cut(s) 53
SetI ASST 1 cut(s) 63
SfaNI GCATC 1 cut(s) 17
SgeI CNNG 3 cut(s) 59, 74, 117
Sse9I AATT 1 cut(s) 36
SspMI CTAG 1 cut(s) 62
TasI AATT 1 cut(s) 36
TspDTI ATGAA 1 cut(s) 12
XspI CTAG 1 cut(s) 62
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.