RchiOBHm_Chr5g0082601

No description available

Basic Information

Type: gene
Biological Identity
rosa_chinensis
5
Physical Location & Seq
Reverse (-)
88547896 .. 88549513
1618 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ35680

Sequence Viewer

Length: 138 bp
ATGATTGCATCTCTCTCTTCTTCATCCAAACCCACAATTTCAGAGCGAGAGAGATCTGAGCTGGGATTGGCCGATTGGGTTCTGAAGTGCTTATTGGGATTTGGGTGGAAACAAGGTAGTGAAGATGAGTACAAATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

45

Amino Acids

5.03

Weight (kDa)

5.14

Isoelectric Point (pI)

54.44

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcoI YGGCCR 1 cut(s) 69
AcuI CTGAAG 1 cut(s) 104
AfaI GTAC 1 cut(s) 131
AjuI GAANNNNNNNTTGG 2 cut(s) 77, 109
AluBI AGCT 1 cut(s) 61
AluI AGCT 1 cut(s) 61
AoxI GGCC 1 cut(s) 69
BglII AGATCT 1 cut(s) 53
BmsI GCATC 1 cut(s) 17
BseGI GGATG 1 cut(s) 23
BseMII CTCAG 1 cut(s) 48
BseYI CCCAGC 1 cut(s) 61
BshFI GGCC 1 cut(s) 71
BsnI GGCC 1 cut(s) 71
Bsp143I GATC 1 cut(s) 53
BspANI GGCC 1 cut(s) 71
BspCNI CTCAG 1 cut(s) 49
BssMI GATC 1 cut(s) 53
Bst6I CTCTTC 1 cut(s) 22
BstDEI CTNAG 1 cut(s) 57
BstF5I GGATG 1 cut(s) 23
BstKTI GATC 1 cut(s) 56
BstMBI GATC 1 cut(s) 53
BstX2I RGATCY 1 cut(s) 53
BstYI RGATCY 1 cut(s) 53
BsuRI GGCC 1 cut(s) 71
BtsCI GGATG 1 cut(s) 23
Csp6I GTAC 1 cut(s) 130
CviJI RGCY 2 cut(s) 61, 71
CviKI_1 RGCY 2 cut(s) 61, 71
CviQI GTAC 1 cut(s) 130
DdeI CTNAG 1 cut(s) 57
DpnI GATC 1 cut(s) 55
DpnII GATC 1 cut(s) 53
EaeI YGGCCR 1 cut(s) 69
Eam1104I CTCTTC 1 cut(s) 22
EarI CTCTTC 1 cut(s) 22
Eco57I CTGAAG 1 cut(s) 104
FokI GGATG 1 cut(s) 10
GsaI CCCAGC 1 cut(s) 65
HaeIII GGCC 1 cut(s) 71
Hpy188I TCNGA 3 cut(s) 43, 58, 84
HpyCH4V TGCA 1 cut(s) 8
HpyF3I CTNAG 1 cut(s) 57
Kzo9I GATC 1 cut(s) 53
LpnPI CCDG 1 cut(s) 47
LweI GCATC 1 cut(s) 17
MalI GATC 1 cut(s) 55
MboI GATC 1 cut(s) 53
MboII GAAGA 3 cut(s) 9, 12, 134
MflI RGATCY 1 cut(s) 53
MluCI AATT 1 cut(s) 36
NdeII GATC 1 cut(s) 53
PspFI CCCAGC 1 cut(s) 61
PsuI RGATCY 1 cut(s) 53
RsaI GTAC 1 cut(s) 131
RsaNI GTAC 1 cut(s) 130
Sau3AI GATC 1 cut(s) 53
SetI ASST 2 cut(s) 63, 118
SfaNI GCATC 1 cut(s) 17
SgeI CNNG 3 cut(s) 59, 74, 125
Sse9I AATT 1 cut(s) 36
TasI AATT 1 cut(s) 36
TatI WGTACW 1 cut(s) 129
TspDTI ATGAA 1 cut(s) 12
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.