RchiOBHm_Chr5g0079721

Leucine Rich repeat

Basic Information

Type: gene
Biological Identity
rosa_chinensis
5
Physical Location & Seq
Forward (+)
85447066 .. 85448520
1455 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ35409

Sequence Viewer

Length: 216 bp
ATGCTAGCCTTCTTTTCGGTGGGCATGAATTTGTTGTCAGGTCTTGGTGCAAAGATTGAGAGAGAGTCCAAGCTGAAGCTCAATGACTTTGACAAGGTTAGGTCATTCAATATTGTGGACTTGTCAGGTTTTTGCAATGTCAGAAATAGCTCTGGGACTTTTTCTAGATGTAGGTGCCTCTTGTTATTTCTCGAAGCTTTTTGGATCCTTTGGTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

71

Amino Acids

8.13

Weight (kDa)

9.06

Isoelectric Point (pI)

35.4

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 174
AclWI GGATC 2 cut(s) 199, 212
AcsI RAATTY 1 cut(s) 28
AcuI CTGAAG 1 cut(s) 95
AgsI TTSAA 1 cut(s) 109
AluBI AGCT 4 cut(s) 73, 79, 150, 197
AluI AGCT 4 cut(s) 73, 79, 150, 197
AlwI GGATC 2 cut(s) 199, 212
ApoI RAATTY 1 cut(s) 28
AsuNHI GCTAGC 1 cut(s) 4
BamHI GGATCC 1 cut(s) 204
BanI GGYRCC 1 cut(s) 174
BfaI CTAG 2 cut(s) 5, 165
BmiI GGNNCC 2 cut(s) 176, 206
BmtI GCTAGC 1 cut(s) 8
Bse3DI GCAATG 1 cut(s) 142
BseMI GCAATG 1 cut(s) 142
BshNI GGYRCC 1 cut(s) 174
BslFI GGGAC 1 cut(s) 169
BsmFI GGGAC 1 cut(s) 169
Bsp143I GATC 1 cut(s) 204
BspLI GGNNCC 2 cut(s) 176, 206
BspOI GCTAGC 1 cut(s) 8
BspPI GGATC 2 cut(s) 199, 212
BspT107I GGYRCC 1 cut(s) 174
BsrDI GCAATG 1 cut(s) 142
BssMI GATC 1 cut(s) 204
BstC8I GCNNGC 1 cut(s) 6
BstKTI GATC 1 cut(s) 207
BstMBI GATC 1 cut(s) 204
BstX2I RGATCY 1 cut(s) 204
BstYI RGATCY 1 cut(s) 204
Cac8I GCNNGC 1 cut(s) 6
CviAII CATG 1 cut(s) 25
CviJI RGCY 5 cut(s) 8, 73, 79, 150, 197
CviKI_1 RGCY 5 cut(s) 8, 73, 79, 150, 197
DpnI GATC 1 cut(s) 206
DpnII GATC 1 cut(s) 204
Eco57I CTGAAG 1 cut(s) 95
FaeI CATG 1 cut(s) 28
FaiI YATR 1 cut(s) 26
FaqI GGGAC 1 cut(s) 169
FatI CATG 1 cut(s) 24
FspBI CTAG 2 cut(s) 5, 165
Hin1II CATG 1 cut(s) 28
HindIII AAGCTT 1 cut(s) 195
HinfI GANTC 1 cut(s) 65
Hpy166II GTNNAC 1 cut(s) 118
Hpy188I TCNGA 1 cut(s) 143
Hpy188III TCNNGA 2 cut(s) 165, 191
Hpy8I GTNNAC 1 cut(s) 118
HpyAV CCTTC 1 cut(s) 19
HpyCH4V TGCA 2 cut(s) 50, 135
Hsp92II CATG 1 cut(s) 28
Kzo9I GATC 1 cut(s) 204
LpnPI CCDG 3 cut(s) 24, 111, 138
MaeI CTAG 2 cut(s) 5, 165
MalI GATC 1 cut(s) 206
MboI GATC 1 cut(s) 204
MflI RGATCY 1 cut(s) 204
MluCI AATT 1 cut(s) 28
MlyI GAGTC 1 cut(s) 74
MnlI CCTC 1 cut(s) 188
NdeII GATC 1 cut(s) 204
NheI GCTAGC 1 cut(s) 4
NlaIII CATG 1 cut(s) 28
NlaIV GGNNCC 2 cut(s) 176, 206
PleI GAGTC 1 cut(s) 73
PpsI GAGTC 1 cut(s) 73
PspN4I GGNNCC 2 cut(s) 176, 206
PsuI RGATCY 1 cut(s) 204
Sau3AI GATC 1 cut(s) 204
SchI GAGTC 1 cut(s) 74
SetI ASST 9 cut(s) 43, 75, 81, 99, 104, 130, 152, 176, 199
Sse9I AATT 1 cut(s) 28
SspI AATATT 1 cut(s) 112
SspMI CTAG 2 cut(s) 5, 165
TaqI TCGA 1 cut(s) 192
TasI AATT 1 cut(s) 28
TspDTI ATGAA 1 cut(s) 41
XapI RAATTY 1 cut(s) 28
XbaI TCTAGA 1 cut(s) 164
XspI CTAG 2 cut(s) 5, 165
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.