RchiOBHm_Chr5g0083021

acyl-activating enzyme 18

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_chinensis
5
OG0005780
Physical Location & Seq
Reverse (-)
88785499 .. 88786246
748 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ35719

Sequence Viewer

Length: 255 bp
ATGACACTAAAAGAACTTCGGGAACAAGTAATGTTGGTGGCTAATGCACTAGACCAGGATGCAACCTTTTCAAAGGGTGATGCCATCGCAATTGACATGCCAATGACAGTCAGTGCAGTTGTCATATATTTGGCAATCATACTAGCAGGATATGTAGTTGTATCAATAGCTGACAGTTTCGCTGTTAACGAAATTGCAACTCGTGTGCGTGTGTCTAAAGCAAAGGGAATCTTTACCCAGGTGGACTTTTCCTAA

Protein Analysis

84

Amino Acids

9.05

Weight (kDa)

4.76

Isoelectric Point (pI)

17.31

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
AMP-binding PF00501 1 - 79 5.4e-13 AMP-binding enzyme
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AgsI TTSAA 1 cut(s) 72
AjnI CCWGG 2 cut(s) 54, 237
AluBI AGCT 1 cut(s) 170
AluI AGCT 1 cut(s) 170
AsuHPI GGTGA 1 cut(s) 89
BauI CACGAG 1 cut(s) 201
BccI CCATC 1 cut(s) 92
BciT130I CCWGG 2 cut(s) 56, 239
BfaI CTAG 2 cut(s) 50, 143
Bme1390I CCNGG 2 cut(s) 56, 239
BmrFI CCNGG 2 cut(s) 56, 239
BmsI GCATC 2 cut(s) 49, 70
BsaJI CCNNGG 1 cut(s) 237
BseBI CCWGG 2 cut(s) 56, 239
BseDI CCNNGG 1 cut(s) 237
BseGI GGATG 1 cut(s) 64
BsgI GTGCAG 1 cut(s) 135
BssECI CCNNGG 1 cut(s) 237
BssSI CACGAG 1 cut(s) 201
Bst2BI CACGAG 1 cut(s) 201
Bst2UI CCWGG 2 cut(s) 56, 239
Bst4CI ACNGT 2 cut(s) 109, 176
BstF5I GGATG 1 cut(s) 64
BstNI CCWGG 2 cut(s) 56, 239
BstNSI RCATGY 1 cut(s) 100
BstSCI CCNGG 2 cut(s) 54, 237
BtgZI GCGATG 1 cut(s) 70
BtsCI GGATG 1 cut(s) 64
BtsIMutI CAGTG 1 cut(s) 118
CviAII CATG 1 cut(s) 97
CviJI RGCY 2 cut(s) 41, 170
CviKI_1 RGCY 2 cut(s) 41, 170
EcoRII CCWGG 2 cut(s) 54, 237
FaeI CATG 1 cut(s) 100
FaiI YATR 5 cut(s) 98, 125, 127, 140, 153
FalI AAGNNNNNCTT 2 cut(s) 215, 247
FatI CATG 1 cut(s) 96
FokI GGATG 1 cut(s) 71
FspBI CTAG 2 cut(s) 50, 143
Hin1II CATG 1 cut(s) 100
HincII GTYRAC 1 cut(s) 187
HindII GTYRAC 1 cut(s) 187
HinfI GANTC 1 cut(s) 228
HpaI GTTAAC 1 cut(s) 187
HphI GGTGA 1 cut(s) 89
Hpy166II GTNNAC 2 cut(s) 187, 244
Hpy188III TCNNGA 1 cut(s) 20
Hpy8I GTNNAC 2 cut(s) 187, 244
HpyCH4III ACNGT 2 cut(s) 109, 176
HpyCH4V TGCA 4 cut(s) 47, 62, 116, 197
Hsp92II CATG 1 cut(s) 100
KspAI GTTAAC 1 cut(s) 187
LpnPI CCDG 5 cut(s) 41, 68, 132, 224, 251
LweI GCATC 2 cut(s) 49, 70
MaeI CTAG 2 cut(s) 50, 143
MfeI CAATTG 1 cut(s) 90
MluCI AATT 2 cut(s) 90, 192
MseI TTAA 1 cut(s) 186
MslI CAYNNNNRTG 1 cut(s) 101
MspR9I CCNGG 2 cut(s) 56, 239
MunI CAATTG 1 cut(s) 90
MvaI CCWGG 2 cut(s) 56, 239
NlaIII CATG 1 cut(s) 100
NspI RCATGY 1 cut(s) 100
PcsI WCGNNNNNNNCGW 1 cut(s) 186
PfeI GAWTC 1 cut(s) 228
Psp6I CCWGG 2 cut(s) 54, 237
PspGI CCWGG 2 cut(s) 54, 237
RseI CAYNNNNRTG 1 cut(s) 101
SaqAI TTAA 1 cut(s) 186
ScrFI CCNGG 2 cut(s) 56, 239
SetI ASST 3 cut(s) 68, 172, 243
SfaNI GCATC 2 cut(s) 49, 70
SmiMI CAYNNNNRTG 1 cut(s) 101
Sse9I AATT 2 cut(s) 90, 192
SspMI CTAG 2 cut(s) 50, 143
StyD4I CCNGG 2 cut(s) 54, 237
TaaI ACNGT 2 cut(s) 109, 176
TasI AATT 2 cut(s) 90, 192
TfiI GAWTC 1 cut(s) 228
Tru1I TTAA 1 cut(s) 186
Tru9I TTAA 1 cut(s) 186
TscAI CASTG 1 cut(s) 118
TspRI CASTG 1 cut(s) 118
XceI RCATGY 1 cut(s) 100
XspI CTAG 2 cut(s) 50, 143
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.