Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_co8133120.1

Orthogroup ID

OG0005780

Physical Location & Seq

Genomic Coordinates Reverse (-)

2 .. 271

Gene Structure 270 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_co8133120.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 185 bp

atggaaatgcatggttcacagcttttaggaacatcatataaggatcctataacaagttttaaccttttccagaaattttctgttgagaatcccgaggcttactggtcaattattctaaaagagctctcaatttcatttcgagaggcccctaagtgtattctagataggactgaaaaatcgaagca

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0005575 GO:0005622 GO:0005623 GO:0005737 GO:0005777 GO:0008150 GO:0008152 GO:0009850 GO:0009987 GO:0010817 GO:0042445 GO:0042579 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0044237 GO:0044424 GO:0044444 GO:0044464 GO:0065007 GO:0065008

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

ACAS_N AMP-binding AMP-binding_C

Protein Analysis

61

Amino Acids

7.08

Weight (kDa)

6.55

Isoelectric Point (pI)

29.97

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0005780)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT1G55320 AT1G55320
fragaria_vesca	FvH4_3g45320 FvH4_3g45320 FvH4_3g45320
malus_domestica	MD03G1006300.v1.1 MD11G1009200.v1.1
prunus_persica	Prupe.6G005900_v2.0.a1
pyrus_communis	pycom03g00640 pycom03g00650
rosa_chinensis	RchiOBHm_Chr5g0083011 RchiOBHm_Chr5g0083021 RchiOBHm_Chr5g0083091
rosa_laevigata	RLG00000037010
rosa_multiflora	Rmu_co8133120.1_g000001 Rmu_sc0003727.1_g000001 Rmu_sc0003727.1_g000005
rosa_roxburghii	Rroxscaffold_1G00001400
rosa_rugosa	Rorug05G0482000 Rorug05G0482100
rosa_samantha	Rh5AG531800 Rh5BG558800 Rh5BG558900 Rh5CG581700 Rh5CG581800 Rh5DG567700
rosa_wichuraiana	Rw5G049660 Rw5G049690

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AclWI	GGATC	2 cut(s)	38, 51
AcsI	RAATTY	1 cut(s)	74
AluBI	AGCT	2 cut(s)	22, 124
AluI	AGCT	2 cut(s)	22, 124
Alw21I	GWGCWC	1 cut(s)	126
AlwI	GGATC	2 cut(s)	38, 51
Ama87I	CYCGRG	1 cut(s)	92
AoxI	GGCC	1 cut(s)	144
ApoI	RAATTY	1 cut(s)	74
AspS9I	GGNCC	1 cut(s)	145
AvaI	CYCGRG	1 cut(s)	92
BamHI	GGATCC	1 cut(s)	43
BanII	GRGCYC	1 cut(s)	126
Bbv12I	GWGCWC	1 cut(s)	126
BfaI	CTAG	1 cut(s)	161
BmeT110I	CYCGRG	1 cut(s)	92
BmgT120I	GGNCC	1 cut(s)	145
BmiI	GGNNCC	2 cut(s)	45, 147
BsaJI	CCNNGG	1 cut(s)	93
Bse1I	ACTGG	1 cut(s)	107
BseDI	CCNNGG	1 cut(s)	93
BseNI	ACTGG	1 cut(s)	107
BshFI	GGCC	1 cut(s)	146
BsiHKAI	GWGCWC	1 cut(s)	126
BsiHKCI	CYCGRG	1 cut(s)	92
BsnI	GGCC	1 cut(s)	146
BsoBI	CYCGRG	1 cut(s)	92
Bsp1286I	GDGCHC	1 cut(s)	126
Bsp143I	GATC	1 cut(s)	43
BspANI	GGCC	1 cut(s)	146
BspLI	GGNNCC	2 cut(s)	45, 147
BspPI	GGATC	2 cut(s)	38, 51
BsrI	ACTGG	1 cut(s)	107
BssECI	CCNNGG	1 cut(s)	93
BssMI	GATC	1 cut(s)	43
BstDEI	CTNAG	1 cut(s)	150
BstKTI	GATC	1 cut(s)	46
BstMBI	GATC	1 cut(s)	43
BstX2I	RGATCY	1 cut(s)	43
BstYI	RGATCY	1 cut(s)	43
BsuRI	GGCC	1 cut(s)	146
Cfr13I	GGNCC	1 cut(s)	145
CviAII	CATG	1 cut(s)	11
CviJI	RGCY	4 cut(s)	22, 98, 124, 146
CviKI_1	RGCY	4 cut(s)	22, 98, 124, 146
DdeI	CTNAG	1 cut(s)	150
DpnI	GATC	1 cut(s)	45
DpnII	GATC	1 cut(s)	43
Ecl136II	GAGCTC	1 cut(s)	124
Eco24I	GRGCYC	1 cut(s)	126
Eco53kI	GAGCTC	1 cut(s)	124
Eco88I	CYCGRG	1 cut(s)	92
EcoICRI	GAGCTC	1 cut(s)	124
EcoO109I	RGGNCCY	1 cut(s)	145
EcoT22I	ATGCAT	1 cut(s)	12
EcoT38I	GRGCYC	1 cut(s)	126
FaeI	CATG	1 cut(s)	14
FaiI	YATR	4 cut(s)	12, 37, 39, 50
FatI	CATG	1 cut(s)	10
FriOI	GRGCYC	1 cut(s)	126
FspBI	CTAG	1 cut(s)	161
HaeIII	GGCC	1 cut(s)	146
Hin1II	CATG	1 cut(s)	14
HinfI	GANTC	1 cut(s)	88
Hpy166II	GTNNAC	1 cut(s)	17
Hpy188III	TCNNGA	4 cut(s)	70, 92, 140, 161
Hpy8I	GTNNAC	1 cut(s)	17
HpyCH4V	TGCA	1 cut(s)	10
HpyF3I	CTNAG	1 cut(s)	150
Hsp92II	CATG	1 cut(s)	14
Kzo9I	GATC	1 cut(s)	43
LpnPI	CCDG	2 cut(s)	83, 88
MaeI	CTAG	1 cut(s)	161
MalI	GATC	1 cut(s)	45
MboI	GATC	1 cut(s)	43
MflI	RGATCY	1 cut(s)	43
MhlI	GDGCHC	1 cut(s)	126
MluCI	AATT	3 cut(s)	74, 108, 129
MnlI	CCTC	2 cut(s)	88, 136
Mph1103I	ATGCAT	1 cut(s)	12
MseI	TTAA	1 cut(s)	60
NdeII	GATC	1 cut(s)	43
NlaIII	CATG	1 cut(s)	14
NlaIV	GGNNCC	2 cut(s)	45, 147
NsiI	ATGCAT	1 cut(s)	12
PfeI	GAWTC	1 cut(s)	88
Psp124BI	GAGCTC	1 cut(s)	126
PspN4I	GGNNCC	2 cut(s)	45, 147
PspPI	GGNCC	1 cut(s)	145
PsuI	RGATCY	1 cut(s)	43
SacI	GAGCTC	1 cut(s)	126
SaqAI	TTAA	1 cut(s)	60
Sau3AI	GATC	1 cut(s)	43
Sau96I	GGNCC	1 cut(s)	145
SduI	GDGCHC	1 cut(s)	126
SetI	ASST	3 cut(s)	24, 66, 126
SgeI	CNNG	8 cut(s)	23, 66, 82, 104, 106, 115, 152, 173
Sse9I	AATT	3 cut(s)	74, 108, 129
SspMI	CTAG	1 cut(s)	161
SstI	GAGCTC	1 cut(s)	126
TaqI	TCGA	2 cut(s)	139, 179
TasI	AATT	3 cut(s)	74, 108, 129
TfiI	GAWTC	1 cut(s)	88
Tru1I	TTAA	1 cut(s)	60
Tru9I	TTAA	1 cut(s)	60
TspDTI	ATGAA	1 cut(s)	123
XapI	RAATTY	1 cut(s)	74
XbaI	TCTAGA	1 cut(s)	160
XspI	CTAG	1 cut(s)	161
Zsp2I	ATGCAT	1 cut(s)	12

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.