Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0003727.1

Orthogroup ID

OG0005780

Physical Location & Seq

Genomic Coordinates Forward (+)

4 .. 3479

Gene Structure 3476 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0003727.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 1479 bp

atgacactaaaagaacttcgggaacaagtaatgttggtggctaatgcactagaccaggaggcaaccttttcaaagggtgatgccatcgcaattgacatgccaatgacagtcagtgcagttatcatatatttggcaatcatactagcaggatatgtagttgtatcaatagctgacagtttcgctgctaacgaaattgcaactcgtctgcgtgtgtctaaagcaaagggaatctttacccaggatttcataatacgaggaggtcgtaaatttcctctgtacagtcgggttgtggatgctgctccatgtaaagctattgtgcttccagcaattgggaacagtgtaggcattcaattacgagaacaggatatatcctggaatgactttctgtctagtgtcaatcatctgccgagaaagaataactacgctccagtctatcagccaatagactccatgacaaatattctcttttcatcaggaactacaggagatccaaaagctatcccatggacacaactttcgccaattcgatgtgcagctgattcatgggctcacattgatactcaagttggagatgtcttctgctggcccacaaatttaggatgggttatgggtccagttttaatctactcatgctttctaagtggtgcaactcttgctctctatcatggatctcctctaggtcgtggcttcggaaagtttgttcaggatgcaggagtcactattttgggtacagttcccagcttagtaaaagcttggaagagtacagagtgtatgaaaggcctagattggacaaagataaaatcattcgcttcgactggtgaagcatctaacgtcgatgacgacctttggctctcttcccgtgcttattacaagcccatccttgaatgctgtggaggcacagaacttgcttcatcctacataatggcaagtccactgcagccacaagcttttgggacctttagcacaaagtcgatgacaacaggctttgttatccttgatgaaagtggagtttcttacccagatgatgaagcttgtgttggggaagtgggtttattccctctgtacatgggagcaactgatagattgctaaatgctgaccatgaagaagtctacttcaagggaatgccaatgtacaatggaatgcaactcaggagacatggagacataatcaaaagaacagttgggggctatttcattgttcaaggcagggctgatgacaccatgaaccttggtggcatcaagacaagttctattgaaattgagcgtgtatgtgaccggtctgatgaaagtatcttggagacagctgcagttagtgttgcaccagtgaatgggggtccggaacagttggttatatacgtggtattaaagaagggatttgagaccaaagcagacgagctaaagacgaaattctcaagagccattcatagcaaccttaatcctttgttcaaggtatcaatacctctaatagttcctatttag

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0005575 GO:0005622 GO:0005623 GO:0005737 GO:0005777 GO:0008150 GO:0008152 GO:0009850 GO:0009987 GO:0010817 GO:0042445 GO:0042579 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0044237 GO:0044424 GO:0044444 GO:0044464 GO:0065007 GO:0065008

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

ACAS_N AMP-binding AMP-binding_C

Protein Analysis

492

Amino Acids

53.6

Weight (kDa)

5.65

Isoelectric Point (pI)

37.5

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0005780)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT1G55320 AT1G55320
fragaria_vesca	FvH4_3g45320 FvH4_3g45320 FvH4_3g45320
malus_domestica	MD03G1006300.v1.1 MD11G1009200.v1.1
prunus_persica	Prupe.6G005900_v2.0.a1
pyrus_communis	pycom03g00640 pycom03g00650
rosa_chinensis	RchiOBHm_Chr5g0083011 RchiOBHm_Chr5g0083021 RchiOBHm_Chr5g0083091
rosa_laevigata	RLG00000037010
rosa_multiflora	Rmu_co8133120.1_g000001 Rmu_sc0003727.1_g000001 Rmu_sc0003727.1_g000005
rosa_roxburghii	Rroxscaffold_1G00001400
rosa_rugosa	Rorug05G0482000 Rorug05G0482100
rosa_samantha	Rh5AG531800 Rh5BG558800 Rh5BG558900 Rh5CG581700 Rh5CG581800 Rh5DG567700
rosa_wichuraiana	Rw5G049660 Rw5G049690

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccB7I	CCANNNNNTGG	2 cut(s)	329, 1328
AccI	GTMKAC	1 cut(s)	1110
AccIII	TCCGGA	1 cut(s)	1336
AclWI	GGATC	2 cut(s)	482, 676
AcsI	RAATTY	3 cut(s)	266, 592, 1406
AfaI	GTAC	5 cut(s)	278, 730, 763, 1064, 1133
AfiI	CCNNNNNNNGG	2 cut(s)	329, 1328
AgeI	ACCGGT	1 cut(s)	1275
AgsI	TTSAA	7 cut(s)	72, 350, 884, 1117, 1202, 1256, 1447
AhdI	GACNNNNNGTC	1 cut(s)	385
AjnI	CCWGG	3 cut(s)	54, 237, 371
AjuI	GAANNNNNNNTTGG	2 cut(s)	1020, 1052
AloI	GAACNNNNNNTCC	2 cut(s)	684, 716
Alw26I	GTCTC	4 cut(s)	1147, 1155, 1292, 1373
AlwI	GGATC	2 cut(s)	482, 676
Aor13HI	TCCGGA	1 cut(s)	1336
AoxI	GGCC	2 cut(s)	584, 778
ApeKI	GCWGC	5 cut(s)	182, 296, 533, 937, 1304
ApoI	RAATTY	3 cut(s)	266, 592, 1406
ArsI	GACNNNNNNTTYG	2 cut(s)	499, 531
AsiGI	ACCGGT	1 cut(s)	1275
AspS9I	GGNCC	4 cut(s)	585, 611, 954, 1334
AsuHPI	GGTGA	2 cut(s)	89, 830
AvaII	GGWCC	3 cut(s)	611, 954, 1334
BaeI	ACNNNNGTAYC	2 cut(s)	549, 582
BanII	GRGCYC	1 cut(s)	550
BbsI	GAAGAC	1 cut(s)	568
BbvI	GCAGC	5 cut(s)	169, 283, 545, 949, 1291
BccI	CCATC	3 cut(s)	92, 594, 884
BciT130I	CCWGG	3 cut(s)	56, 239, 373
BcoDI	GTCTC	4 cut(s)	1147, 1155, 1292, 1373
BfaI	CTAG	5 cut(s)	50, 143, 390, 677, 782
BfmI	CTRYAG	3 cut(s)	480, 935, 1305
BisI	GCNGC	5 cut(s)	183, 297, 534, 938, 1305
BlsI	GCNGC	5 cut(s)	184, 298, 535, 939, 1306
Bme1390I	CCNGG	3 cut(s)	56, 239, 373
Bme18I	GGWCC	3 cut(s)	611, 954, 1334
BmeRI	GACNNNNNGTC	1 cut(s)	385
BmgT120I	GGNCC	4 cut(s)	585, 611, 954, 1334
BmiI	GGNNCC	3 cut(s)	612, 955, 1335
BmrFI	CCNGG	3 cut(s)	56, 239, 373
BmsI	GCATC	5 cut(s)	70, 283, 697, 833, 1245
BpiI	GAAGAC	1 cut(s)	568
BpmI	CTGGAG	1 cut(s)	411
BpuEI	CTTGAG	2 cut(s)	546, 1396
BsaAI	YACGTR	1 cut(s)	1357
BsaI	GGTCTC	1 cut(s)	1373
BsaJI	CCNNGG	3 cut(s)	237, 503, 1228
BsaWI	WCCGGW	2 cut(s)	1275, 1336
Bsc4I	CCNNNNNNNGG	2 cut(s)	329, 1328
Bse118I	RCCGGY	1 cut(s)	1275
Bse1I	ACTGG	4 cut(s)	428, 614, 820, 1322
BseAI	TCCGGA	1 cut(s)	1336
BseBI	CCWGG	3 cut(s)	56, 239, 373
BseDI	CCNNGG	3 cut(s)	237, 503, 1228
BseGI	GGATG	5 cut(s)	298, 605, 712, 876, 911
BseLI	CCNNNNNNNGG	2 cut(s)	329, 1328
BseMII	CTCAG	1 cut(s)	1162
BseNI	ACTGG	4 cut(s)	428, 614, 820, 1322
BseRI	GAGGAG	2 cut(s)	270, 663
BseXI	GCAGC	5 cut(s)	169, 283, 545, 949, 1291
BseYI	CCCAGC	1 cut(s)	737
BsgI	GTGCAG	2 cut(s)	135, 552
BshFI	GGCC	2 cut(s)	586, 780
BshTI	ACCGGT	1 cut(s)	1275
BsiSI	CCGG	2 cut(s)	1276, 1337
BslFI	GGGAC	1 cut(s)	967
BslI	CCNNNNNNNGG	2 cut(s)	329, 1328
BsmAI	GTCTC	4 cut(s)	1147, 1155, 1292, 1373
BsmFI	GGGAC	1 cut(s)	967
BsmI	GAATGC	4 cut(s)	345, 890, 1128, 1146
BsnI	GGCC	2 cut(s)	586, 780
Bso31I	GGTCTC	1 cut(s)	1373
Bsp1286I	GDGCHC	1 cut(s)	550
Bsp13I	TCCGGA	1 cut(s)	1336
Bsp1407I	TGTACA	3 cut(s)	276, 1062, 1131
Bsp143I	GATC	2 cut(s)	487, 668
Bsp19I	CCATGG	1 cut(s)	503
BspANI	GGCC	2 cut(s)	586, 780
BspCNI	CTCAG	1 cut(s)	1161
BspEI	TCCGGA	1 cut(s)	1336
BspLI	GGNNCC	3 cut(s)	612, 955, 1335
BspMAI	CTGCAG	2 cut(s)	939, 1309
BspPI	GGATC	2 cut(s)	482, 676
BspTNI	GGTCTC	1 cut(s)	1373
BsrFI	RCCGGY	1 cut(s)	1275
BsrGI	TGTACA	3 cut(s)	276, 1062, 1131
BsrI	ACTGG	4 cut(s)	428, 614, 820, 1322
BssAI	RCCGGY	1 cut(s)	1275
BssECI	CCNNGG	3 cut(s)	237, 503, 1228
BssMI	GATC	2 cut(s)	487, 668
BssT1I	CCWWGG	2 cut(s)	503, 1228
Bst2UI	CCWGG	3 cut(s)	56, 239, 373
Bst4CI	ACNGT	7 cut(s)	109, 176, 281, 338, 733, 1180, 1344
Bst6I	CTCTTC	2 cut(s)	752, 859
BstAPI	GCANNNNNTGC	1 cut(s)	653
BstAUI	TGTACA	3 cut(s)	276, 1062, 1131
BstBAI	YACGTR	1 cut(s)	1357
BstC8I	GCNNGC	1 cut(s)	584
BstDEI	CTNAG	3 cut(s)	638, 742, 1148
BstDSI	CCRYGG	1 cut(s)	503
BstF5I	GGATG	5 cut(s)	298, 605, 712, 876, 911
BstKTI	GATC	2 cut(s)	490, 671
BstMAI	GTCTC	4 cut(s)	1147, 1155, 1292, 1373
BstMBI	GATC	2 cut(s)	487, 668
BstMWI	GCNNNNNNNGC	2 cut(s)	653, 894
BstNI	CCWGG	3 cut(s)	56, 239, 373
BstNSI	RCATGY	1 cut(s)	100
BstSCI	CCNGG	3 cut(s)	54, 237, 371
BstSFI	CTRYAG	3 cut(s)	480, 935, 1305
BstV1I	GCAGC	5 cut(s)	169, 283, 545, 949, 1291
BstV2I	GAAGAC	1 cut(s)	568
BstX2I	RGATCY	2 cut(s)	487, 668
BstYI	RGATCY	2 cut(s)	487, 668
BsuRI	GGCC	2 cut(s)	586, 780
BtgI	CCRYGG	1 cut(s)	503
BtgZI	GCGATG	1 cut(s)	70
BtsCI	GGATG	5 cut(s)	298, 605, 712, 876, 911
BtsI	GCAGTG	1 cut(s)	932
BtsIMutI	CAGTG	4 cut(s)	118, 343, 932, 1329
Cac8I	GCNNGC	1 cut(s)	584
Cfr10I	RCCGGY	1 cut(s)	1275
Cfr13I	GGNCC	4 cut(s)	585, 611, 954, 1334
Csp6I	GTAC	5 cut(s)	277, 729, 762, 1063, 1132
CspAI	ACCGGT	1 cut(s)	1275
CviQI	GTAC	5 cut(s)	277, 729, 762, 1063, 1132
DdeI	CTNAG	3 cut(s)	638, 742, 1148
DpnI	GATC	2 cut(s)	489, 670
DpnII	GATC	2 cut(s)	487, 668
DriI	GACNNNNNGTC	1 cut(s)	385
Eam1104I	CTCTTC	2 cut(s)	752, 859
Eam1105I	GACNNNNNGTC	1 cut(s)	385
EarI	CTCTTC	2 cut(s)	752, 859
Eco130I	CCWWGG	2 cut(s)	503, 1228
Eco147I	AGGCCT	1 cut(s)	780
Eco24I	GRGCYC	1 cut(s)	550
Eco31I	GGTCTC	1 cut(s)	1373
Eco47I	GGWCC	3 cut(s)	611, 954, 1334
EcoO109I	RGGNCCY	1 cut(s)	954
EcoRII	CCWGG	3 cut(s)	54, 237, 371
EcoT14I	CCWWGG	2 cut(s)	503, 1228
EcoT38I	GRGCYC	1 cut(s)	550
ErhI	CCWWGG	2 cut(s)	503, 1228
FalI	AAGNNNNNCTT	2 cut(s)	215, 247
FaqI	GGGAC	1 cut(s)	967
FblI	GTMKAC	1 cut(s)	1110
Fnu4HI	GCNGC	5 cut(s)	183, 297, 534, 938, 1305
FokI	GGATG	5 cut(s)	305, 612, 719, 863, 898
FriOI	GRGCYC	1 cut(s)	550
Fsp4HI	GCNGC	5 cut(s)	183, 297, 534, 938, 1305
FspBI	CTAG	5 cut(s)	50, 143, 390, 677, 782
GluI	GCNGC	5 cut(s)	183, 297, 534, 938, 1305
GsaI	CCCAGC	1 cut(s)	741
GsuI	CTGGAG	1 cut(s)	411
HaeIII	GGCC	2 cut(s)	586, 780
HapII	CCGG	2 cut(s)	1276, 1337
HindIII	AAGCTT	3 cut(s)	750, 945, 1029
HinfI	GANTC	4 cut(s)	228, 446, 539, 714
HpaII	CCGG	2 cut(s)	1276, 1337
HphI	GGTGA	2 cut(s)	89, 830
Hpy166II	GTNNAC	2 cut(s)	932, 1111
Hpy188I	TCNGA	2 cut(s)	692, 1282
Hpy188III	TCNNGA	7 cut(s)	20, 474, 704, 1150, 1240, 1337, 1413
Hpy8I	GTNNAC	2 cut(s)	932, 1111
Hpy99I	CGWCG	1 cut(s)	836
HpyAV	CCTTC	1 cut(s)	1363
HpyCH4III	ACNGT	7 cut(s)	109, 176, 281, 338, 733, 1180, 1344
HpyCH4IV	ACGT	2 cut(s)	831, 1356
HpyF10VI	GCNNNNNNNGC	2 cut(s)	653, 894
HpyF3I	CTNAG	3 cut(s)	638, 742, 1148
HpySE526I	ACGT	2 cut(s)	831, 1356
Kpn2I	TCCGGA	1 cut(s)	1336
Kzo9I	GATC	2 cut(s)	487, 668
LmnI	GCTCC	3 cut(s)	304, 430, 1070
Lsp1109I	GCAGC	5 cut(s)	169, 283, 545, 949, 1291
LweI	GCATC	5 cut(s)	70, 283, 697, 833, 1245
MaeI	CTAG	5 cut(s)	50, 143, 390, 677, 782
MaeII	ACGT	2 cut(s)	831, 1356
MaeIII	GTNAC	2 cut(s)	715, 1271
MalI	GATC	2 cut(s)	489, 670
MboI	GATC	2 cut(s)	487, 668
MboII	GAAGA	4 cut(s)	568, 769, 846, 1115
MfeI	CAATTG	2 cut(s)	90, 327
MflI	RGATCY	2 cut(s)	487, 668
MhlI	GDGCHC	1 cut(s)	550
MluCI	AATT	9 cut(s)	90, 192, 266, 327, 350, 522, 592, 1257, 1406
MlyI	GAGTC	2 cut(s)	440, 723
MmeI	TCCRAC	1 cut(s)	547
MnlI	CCTC	8 cut(s)	52, 248, 251, 282, 684, 887, 1068, 1470
MroI	TCCGGA	1 cut(s)	1336
MseI	TTAA	3 cut(s)	620, 1364, 1434
MslI	CAYNNNNRTG	1 cut(s)	101
MspA1I	CMGCKG	2 cut(s)	536, 1304
MspI	CCGG	2 cut(s)	1276, 1337
MspR9I	CCNGG	3 cut(s)	56, 239, 373
MunI	CAATTG	2 cut(s)	90, 327
Mva1269I	GAATGC	4 cut(s)	345, 890, 1128, 1146
MvaI	CCWGG	3 cut(s)	56, 239, 373
MwoI	GCNNNNNNNGC	2 cut(s)	653, 894
NcoI	CCATGG	1 cut(s)	503
NdeII	GATC	2 cut(s)	487, 668
NlaIV	GGNNCC	3 cut(s)	612, 955, 1335
NmeAIII	GCCGAG	1 cut(s)	432
NmuCI	GTSAC	2 cut(s)	715, 1271
NspI	RCATGY	1 cut(s)	100
PceI	AGGCCT	1 cut(s)	780
PcsI	WCGNNNNNNNCGW	3 cut(s)	186, 259, 837
PctI	GAATGC	4 cut(s)	345, 890, 1128, 1146
PfeI	GAWTC	2 cut(s)	228, 539
PflMI	CCANNNNNTGG	2 cut(s)	329, 1328
PfoI	TCCNGGA	1 cut(s)	371
PinAI	ACCGGT	1 cut(s)	1275
PkrI	GCNGC	5 cut(s)	184, 298, 535, 939, 1306
PleI	GAGTC	2 cut(s)	440, 722
PpsI	GAGTC	2 cut(s)	440, 722
Ppu21I	YACGTR	1 cut(s)	1357
PpuMI	RGGWCCY	1 cut(s)	954
Psp5II	RGGWCCY	1 cut(s)	954
Psp6I	CCWGG	3 cut(s)	54, 237, 371
PspFI	CCCAGC	1 cut(s)	737
PspGI	CCWGG	3 cut(s)	54, 237, 371
PspN4I	GGNNCC	3 cut(s)	612, 955, 1335
PspPI	GGNCC	4 cut(s)	585, 611, 954, 1334
PspPPI	RGGWCCY	1 cut(s)	954
PstI	CTGCAG	2 cut(s)	939, 1309
PsuI	RGATCY	2 cut(s)	487, 668
PvuII	CAGCTG	2 cut(s)	536, 1304
RsaI	GTAC	5 cut(s)	278, 730, 763, 1064, 1133
RsaNI	GTAC	5 cut(s)	277, 729, 762, 1063, 1132
RseI	CAYNNNNRTG	1 cut(s)	101
SaqAI	TTAA	3 cut(s)	620, 1364, 1434
SatI	GCNGC	5 cut(s)	183, 297, 534, 938, 1305
Sau3AI	GATC	2 cut(s)	487, 668
Sau96I	GGNCC	4 cut(s)	585, 611, 954, 1334
SchI	GAGTC	2 cut(s)	440, 723
ScrFI	CCNGG	3 cut(s)	56, 239, 373
SduI	GDGCHC	1 cut(s)	550
SfaNI	GCATC	5 cut(s)	70, 283, 697, 833, 1245
SfcI	CTRYAG	3 cut(s)	480, 935, 1305
SinI	GGWCC	3 cut(s)	611, 954, 1334
SmiMI	CAYNNNNRTG	1 cut(s)	101
SmlI	CTYRAG	2 cut(s)	561, 1411
SmoI	CTYRAG	2 cut(s)	561, 1411
Sse9I	AATT	9 cut(s)	90, 192, 266, 327, 350, 522, 592, 1257, 1406
SseBI	AGGCCT	1 cut(s)	780
SspI	AATATT	1 cut(s)	460
SspMI	CTAG	5 cut(s)	50, 143, 390, 677, 782
StuI	AGGCCT	1 cut(s)	780
StyD4I	CCNGG	3 cut(s)	54, 237, 371
StyI	CCWWGG	2 cut(s)	503, 1228
TaaI	ACNGT	7 cut(s)	109, 176, 281, 338, 733, 1180, 1344
TaiI	ACGT	2 cut(s)	834, 1359
TaqI	TCGA	4 cut(s)	526, 812, 834, 971
TasI	AATT	9 cut(s)	90, 192, 266, 327, 350, 522, 592, 1257, 1406
TatI	WGTACW	4 cut(s)	276, 761, 1062, 1131
TfiI	GAWTC	2 cut(s)	228, 539
Tru1I	TTAA	3 cut(s)	620, 1364, 1434
Tru9I	TTAA	3 cut(s)	620, 1364, 1434
TscAI	CASTG	4 cut(s)	118, 343, 939, 1329
TseFI	GTSAC	2 cut(s)	715, 1271
TseI	GCWGC	5 cut(s)	182, 296, 533, 937, 1304
Tsp45I	GTSAC	2 cut(s)	715, 1271
TspRI	CASTG	4 cut(s)	118, 343, 939, 1329
Van91I	CCANNNNNTGG	2 cut(s)	329, 1328
VpaK11BI	GGWCC	3 cut(s)	611, 954, 1334
XapI	RAATTY	3 cut(s)	266, 592, 1406
XceI	RCATGY	1 cut(s)	100
XmiI	GTMKAC	1 cut(s)	1110
XspI	CTAG	5 cut(s)	50, 143, 390, 677, 782

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.