RchiOBHm_Chr6g0271031

Regulator of nonsense transcripts

Basic Information

Type: gene
Biological Identity
rosa_chinensis
6
Physical Location & Seq
Forward (+)
29064166 .. 29064443
278 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ24313

Sequence Viewer

Length: 180 bp
ATGAAGAACCCCTCGGTGAGAACGAAAGTATTAGTTCAGCACCTGCCTCCGTCTCTGTCTCAGTCCGATTTCATTCAACAAATCGACCACTTCTTCTGTGATCGCCACAACTGGTTTTGCTTTCAAATCATGGACGATCATACCAACACAGAAAACCTCCAAGCCATTCGTCACTCCTAG

Protein Analysis

59

Amino Acids

7.05

Weight (kDa)

6.48

Isoelectric Point (pI)

46.2

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Smg4_UPF3 PF03467 7 - 45 2.6e-07 Smg-4/UPF3 family
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AarI CACCTGC 1 cut(s) 51
Acc36I ACCTGC 1 cut(s) 51
AgsI TTSAA 2 cut(s) 77, 125
Alw26I GTCTC 2 cut(s) 57, 63
AlwNI CAGNNNCTG 1 cut(s) 43
AsuHPI GGTGA 1 cut(s) 28
BcoDI GTCTC 2 cut(s) 57, 63
BfaI CTAG 1 cut(s) 178
BfuAI ACCTGC 1 cut(s) 51
BsaJI CCNNGG 1 cut(s) 12
Bse1I ACTGG 1 cut(s) 116
BseDI CCNNGG 1 cut(s) 12
BseMII CTCAG 1 cut(s) 74
BseNI ACTGG 1 cut(s) 116
BsmAI GTCTC 2 cut(s) 57, 63
BsmBI CGTCTC 1 cut(s) 57
Bsp143I GATC 2 cut(s) 100, 136
BspCNI CTCAG 1 cut(s) 73
BspMI ACCTGC 1 cut(s) 51
BsrI ACTGG 1 cut(s) 116
BssECI CCNNGG 1 cut(s) 12
BssMI GATC 2 cut(s) 100, 136
BstDEI CTNAG 1 cut(s) 60
BstKTI GATC 2 cut(s) 103, 139
BstMAI GTCTC 2 cut(s) 57, 63
BstMBI GATC 2 cut(s) 100, 136
BveI ACCTGC 1 cut(s) 51
CaiI CAGNNNCTG 1 cut(s) 43
CviAII CATG 1 cut(s) 130
CviJI RGCY 1 cut(s) 164
CviKI_1 RGCY 1 cut(s) 164
DdeI CTNAG 1 cut(s) 60
DpnI GATC 2 cut(s) 102, 138
DpnII GATC 2 cut(s) 100, 136
Esp3I CGTCTC 1 cut(s) 57
FaeI CATG 1 cut(s) 133
FaiI YATR 2 cut(s) 131, 141
FatI CATG 1 cut(s) 129
FspBI CTAG 1 cut(s) 178
Hin1II CATG 1 cut(s) 133
HphI GGTGA 1 cut(s) 28
Hpy188I TCNGA 1 cut(s) 67
HpyF3I CTNAG 1 cut(s) 60
Hsp92II CATG 1 cut(s) 133
Kzo9I GATC 2 cut(s) 100, 136
LpnPI CCDG 2 cut(s) 56, 97
MaeI CTAG 1 cut(s) 178
MaeIII GTNAC 1 cut(s) 170
MalI GATC 2 cut(s) 102, 138
MboI GATC 2 cut(s) 100, 136
MboII GAAGA 2 cut(s) 16, 85
MnlI CCTC 3 cut(s) 22, 57, 167
NdeII GATC 2 cut(s) 100, 136
NlaIII CATG 1 cut(s) 133
NmuCI GTSAC 1 cut(s) 170
PaqCI CACCTGC 1 cut(s) 51
PcsI WCGNNNNNNNCGW 1 cut(s) 20
PstNI CAGNNNCTG 1 cut(s) 43
Sau3AI GATC 2 cut(s) 100, 136
SetI ASST 2 cut(s) 45, 159
SgeI CNNG 5 cut(s) 25, 55, 124, 142, 173
SspMI CTAG 1 cut(s) 178
TaqI TCGA 1 cut(s) 84
TseFI GTSAC 1 cut(s) 170
Tsp45I GTSAC 1 cut(s) 170
TspDTI ATGAA 2 cut(s) 17, 61
TspGWI ACGGA 1 cut(s) 39
XspI CTAG 1 cut(s) 178
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.