RchiOBHm_Chr6g0271181

Belongs to the helicase family. Dicer subfamily

Basic Information

Type: gene
Biological Identity
rosa_chinensis
6
Physical Location & Seq
Forward (+)
29688000 .. 29688798
799 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ24327

Sequence Viewer

Length: 261 bp
ATGACGCCTCCTCAGATTCTTTTGGATGCCTTAAGAAAGGCATTCTTGACCATAGAAGCAGTATGCTTGATGGTTATGGATGAGTGCCATCGGGCTACCGGAAGCCACCCTTATACAAAGATAATGAAGGTTGATTTTGTTGTTGTGTTCCTCCCATTTCTTTGTTGTGATTTGTTAAGAGATATGCATAGTTATATCGTTTGTTGTCGACCAACTTGGCAATATTTTCTCTTTGGGTGCAGGAATTTATCACAGGTCTAG
Functional Annotation
KEGG Pathways
Metabolic & Signaling

Protein Analysis

86

Amino Acids

10.0

Weight (kDa)

7.58

Isoelectric Point (pI)

44.89

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0017761)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 208
AcsI RAATTY 1 cut(s) 244
AcyI GRCGYC 1 cut(s) 5
AflII CTTAAG 1 cut(s) 31
ApoI RAATTY 1 cut(s) 244
BccI CCATC 2 cut(s) 64, 96
BfaI CTAG 1 cut(s) 259
BfrI CTTAAG 1 cut(s) 31
BmsI GCATC 1 cut(s) 16
BsaHI GRCGYC 1 cut(s) 5
BsaWI WCCGGW 1 cut(s) 98
BseGI GGATG 2 cut(s) 31, 85
BseMII CTCAG 1 cut(s) 26
BsgI GTGCAG 1 cut(s) 259
BsiSI CCGG 1 cut(s) 99
BsmI GAATGC 1 cut(s) 41
BspCNI CTCAG 1 cut(s) 25
BspTI CTTAAG 1 cut(s) 31
BssNI GRCGYC 1 cut(s) 5
BstACI GRCGYC 1 cut(s) 5
BstAFI CTTAAG 1 cut(s) 31
BstDEI CTNAG 1 cut(s) 12
BstF5I GGATG 2 cut(s) 31, 85
BtsCI GGATG 2 cut(s) 31, 85
CseI GACGC 1 cut(s) 13
CviJI RGCY 2 cut(s) 95, 105
CviKI_1 RGCY 2 cut(s) 95, 105
DdeI CTNAG 1 cut(s) 12
EcoT22I ATGCAT 1 cut(s) 189
FaiI YATR 7 cut(s) 53, 64, 77, 114, 185, 189, 195
FalI AAGNNNNNCTT 4 cut(s) 29, 61, 94, 126
FblI GTMKAC 1 cut(s) 208
FokI GGATG 2 cut(s) 38, 92
FspBI CTAG 1 cut(s) 259
HapII CCGG 1 cut(s) 99
HgaI GACGC 1 cut(s) 13
Hin1I GRCGYC 1 cut(s) 5
HincII GTYRAC 1 cut(s) 209
HindII GTYRAC 1 cut(s) 209
HinfI GANTC 1 cut(s) 16
HpaII CCGG 1 cut(s) 99
Hpy166II GTNNAC 1 cut(s) 209
Hpy188I TCNGA 1 cut(s) 15
Hpy188III TCNNGA 1 cut(s) 46
Hpy8I GTNNAC 1 cut(s) 209
HpyAV CCTTC 1 cut(s) 121
HpyCH4V TGCA 2 cut(s) 187, 240
HpyF3I CTNAG 1 cut(s) 12
Hsp92I GRCGYC 1 cut(s) 5
LpnPI CCDG 3 cut(s) 112, 226, 239
LweI GCATC 1 cut(s) 16
MaeI CTAG 1 cut(s) 259
MluCI AATT 1 cut(s) 244
MnlI CCTC 3 cut(s) 18, 21, 161
Mph1103I ATGCAT 1 cut(s) 189
MseI TTAA 2 cut(s) 32, 176
MspCI CTTAAG 1 cut(s) 31
MspI CCGG 1 cut(s) 99
Mva1269I GAATGC 1 cut(s) 41
NsiI ATGCAT 1 cut(s) 189
PctI GAATGC 1 cut(s) 41
PfeI GAWTC 1 cut(s) 16
SalI GTCGAC 1 cut(s) 207
SaqAI TTAA 2 cut(s) 32, 176
SetI ASST 2 cut(s) 132, 258
SfaNI GCATC 1 cut(s) 16
SgeI CNNG 6 cut(s) 58, 79, 104, 111, 228, 253
SmlI CTYRAG 1 cut(s) 31
SmoI CTYRAG 1 cut(s) 31
Sse9I AATT 1 cut(s) 244
SspI AATATT 1 cut(s) 224
SspMI CTAG 1 cut(s) 259
TaqI TCGA 1 cut(s) 208
TasI AATT 1 cut(s) 244
TfiI GAWTC 1 cut(s) 16
Tru1I TTAA 2 cut(s) 32, 176
Tru9I TTAA 2 cut(s) 32, 176
TspDTI ATGAA 1 cut(s) 140
Vha464I CTTAAG 1 cut(s) 31
XapI RAATTY 1 cut(s) 244
XmiI GTMKAC 1 cut(s) 208
XspI CTAG 1 cut(s) 259
Zsp2I ATGCAT 1 cut(s) 189
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.