Rmu_co8257479.1_g000001

Belongs to the helicase family. Dicer subfamily

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8257479.1
Physical Location & Seq
Reverse (-)
2 .. 603
602 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8257479.1_g000001.1.cds

Sequence Viewer

Length: 416 bp
atgcatttgccagaggaagaaggccagattcccctgaaacgcagcctcactgaaaccactgatgatcatggtgccgccgccgatcaaggagtttcaaagcgcctcaatcccagaaggtatcagacacaagtgtatgaggttgctagaaagaggaacacaatagctgtgatggagacaggaactggcaagacaatgatagctgtgatgctcattgatgaaattggtcatgctatcaagtcatctggtgacaacaaattgatcatattcttggccccaactgttcatcttgttcatcagcaatttgaggttattaaagaacacactacttttaaagtagaggagtattacggagccaagggggttgatgcgtgggttaaggagcattgggaaaaggaatttaaaacccatgatgtaag
Functional Annotation
KEGG Pathways
Metabolic & Signaling

Protein Analysis

138

Amino Acids

15.74

Weight (kDa)

6.23

Isoelectric Point (pI)

29.46

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0017761)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 71
AciI CCGC 2 cut(s) 75, 78
AcsI RAATTY 1 cut(s) 395
AgsI TTSAA 1 cut(s) 96
AluBI AGCT 2 cut(s) 164, 200
AluI AGCT 2 cut(s) 164, 200
Alw26I GTCTC 1 cut(s) 167
AlwNI CAGNNNCTG 1 cut(s) 182
AoxI GGCC 2 cut(s) 22, 270
ApeKI GCWGC 1 cut(s) 42
ApoI RAATTY 1 cut(s) 395
AspLEI GCGC 1 cut(s) 102
AspS9I GGNCC 1 cut(s) 271
AsuHPI GGTGA 1 cut(s) 257
BanI GGYRCC 1 cut(s) 71
BbvI GCAGC 1 cut(s) 54
BccI CCATC 1 cut(s) 163
BclI TGATCA 2 cut(s) 64, 258
BcoDI GTCTC 1 cut(s) 167
BfaI CTAG 1 cut(s) 144
BfoI RGCGCY 1 cut(s) 103
BisI GCNGC 3 cut(s) 43, 75, 78
BlsI GCNGC 3 cut(s) 44, 76, 79
BmgT120I GGNCC 1 cut(s) 271
BmiI GGNNCC 3 cut(s) 73, 273, 352
BmsI GCATC 2 cut(s) 195, 355
BsaJI CCNNGG 1 cut(s) 354
Bse1I ACTGG 1 cut(s) 187
BseDI CCNNGG 1 cut(s) 354
BseNI ACTGG 1 cut(s) 187
BseRI GAGGAG 1 cut(s) 353
BseXI GCAGC 1 cut(s) 54
BshFI GGCC 2 cut(s) 24, 272
BshNI GGYRCC 1 cut(s) 71
BsmAI GTCTC 1 cut(s) 167
BsnI GGCC 2 cut(s) 24, 272
Bsp143I GATC 3 cut(s) 64, 82, 258
BspACI CCGC 2 cut(s) 75, 78
BspANI GGCC 2 cut(s) 24, 272
BspLI GGNNCC 3 cut(s) 73, 273, 352
BspT107I GGYRCC 1 cut(s) 71
BsrI ACTGG 1 cut(s) 187
BssECI CCNNGG 1 cut(s) 354
BssMI GATC 3 cut(s) 64, 82, 258
BssT1I CCWWGG 1 cut(s) 354
Bst4CI ACNGT 1 cut(s) 280
BstH2I RGCGCY 1 cut(s) 103
BstHHI GCGC 1 cut(s) 102
BstKTI GATC 3 cut(s) 67, 85, 261
BstMAI GTCTC 1 cut(s) 167
BstMBI GATC 3 cut(s) 64, 82, 258
BstV1I GCAGC 1 cut(s) 54
BsuRI GGCC 2 cut(s) 24, 272
BtsIMutI CAGTG 2 cut(s) 48, 57
CaiI CAGNNNCTG 1 cut(s) 182
CfoI GCGC 1 cut(s) 102
Cfr13I GGNCC 1 cut(s) 271
CviAII CATG 3 cut(s) 68, 227, 407
CviJI RGCY 6 cut(s) 24, 45, 164, 200, 272, 353
CviKI_1 RGCY 6 cut(s) 24, 45, 164, 200, 272, 353
DpnI GATC 3 cut(s) 66, 84, 260
DpnII GATC 3 cut(s) 64, 82, 258
DraI TTTAAA 2 cut(s) 331, 400
Eco130I CCWWGG 1 cut(s) 354
EcoT14I CCWWGG 1 cut(s) 354
EcoT22I ATGCAT 1 cut(s) 6
ErhI CCWWGG 1 cut(s) 354
FaeI CATG 3 cut(s) 71, 230, 410
FaiI YATR 5 cut(s) 69, 135, 228, 263, 408
FatI CATG 3 cut(s) 67, 226, 406
FbaI TGATCA 2 cut(s) 64, 258
Fnu4HI GCNGC 3 cut(s) 43, 75, 78
Fsp4HI GCNGC 3 cut(s) 43, 75, 78
FspBI CTAG 1 cut(s) 144
GlaI GCGC 1 cut(s) 101
GluI GCNGC 3 cut(s) 43, 75, 78
HaeII RGCGCY 1 cut(s) 103
HaeIII GGCC 2 cut(s) 24, 272
HhaI GCGC 1 cut(s) 102
Hin1II CATG 3 cut(s) 71, 230, 410
Hin6I GCGC 1 cut(s) 100
HinP1I GCGC 1 cut(s) 100
HinfI GANTC 1 cut(s) 28
HphI GGTGA 1 cut(s) 257
Hpy188I TCNGA 1 cut(s) 123
HpyAV CCTTC 2 cut(s) 14, 108
HpyCH4III ACNGT 1 cut(s) 280
HpyCH4V TGCA 1 cut(s) 4
Hsp92II CATG 3 cut(s) 71, 230, 410
HspAI GCGC 1 cut(s) 100
Ksp22I TGATCA 2 cut(s) 64, 258
Kzo9I GATC 3 cut(s) 64, 82, 258
LmnI GCTCC 2 cut(s) 350, 379
LpnPI CCDG 7 cut(s) 24, 38, 47, 124, 162, 168, 228
Lsp1109I GCAGC 1 cut(s) 54
LweI GCATC 2 cut(s) 195, 355
MaeI CTAG 1 cut(s) 144
MaeIII GTNAC 1 cut(s) 245
MalI GATC 3 cut(s) 66, 84, 260
MboI GATC 3 cut(s) 64, 82, 258
MboII GAAGA 1 cut(s) 29
MluCI AATT 4 cut(s) 219, 254, 299, 395
MnlI CCTC 7 cut(s) 7, 56, 113, 130, 144, 298, 331
Mph1103I ATGCAT 1 cut(s) 6
MseI TTAA 4 cut(s) 312, 330, 375, 399
NdeII GATC 3 cut(s) 64, 82, 258
NlaIII CATG 3 cut(s) 71, 230, 410
NlaIV GGNNCC 3 cut(s) 73, 273, 352
NmuCI GTSAC 1 cut(s) 245
NsiI ATGCAT 1 cut(s) 6
PfeI GAWTC 1 cut(s) 28
PkrI GCNGC 3 cut(s) 44, 76, 79
PspN4I GGNNCC 3 cut(s) 73, 273, 352
PspPI GGNCC 1 cut(s) 271
PstNI CAGNNNCTG 1 cut(s) 182
SaqAI TTAA 4 cut(s) 312, 330, 375, 399
SatI GCNGC 3 cut(s) 43, 75, 78
Sau3AI GATC 3 cut(s) 64, 82, 258
Sau96I GGNCC 1 cut(s) 271
SetI ASST 5 cut(s) 119, 141, 166, 202, 309
SfaNI GCATC 2 cut(s) 195, 355
Sse9I AATT 4 cut(s) 219, 254, 299, 395
SsiI CCGC 2 cut(s) 75, 78
SspMI CTAG 1 cut(s) 144
StyI CCWWGG 1 cut(s) 354
TaaI ACNGT 1 cut(s) 280
TasI AATT 4 cut(s) 219, 254, 299, 395
TauI GCSGC 2 cut(s) 77, 80
TfiI GAWTC 1 cut(s) 28
Tru1I TTAA 4 cut(s) 312, 330, 375, 399
Tru9I TTAA 4 cut(s) 312, 330, 375, 399
TscAI CASTG 2 cut(s) 55, 64
TseFI GTSAC 1 cut(s) 245
TseI GCWGC 1 cut(s) 42
Tsp45I GTSAC 1 cut(s) 245
TspDTI ATGAA 3 cut(s) 231, 272, 281
TspGWI ACGGA 1 cut(s) 363
TspRI CASTG 2 cut(s) 55, 64
XapI RAATTY 1 cut(s) 395
XspI CTAG 1 cut(s) 144
Zsp2I ATGCAT 1 cut(s) 6
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.