RchiOBHm_Chr6g0286981

No description available

Basic Information

Type: gene
Biological Identity
rosa_chinensis
6
Physical Location & Seq
Reverse (-)
50359188 .. 50359594
407 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ25742

Sequence Viewer

Length: 189 bp
ATGGAAAGAAAAGGATTAAAAAGGAAACAGTTGACAAGGAGGCCAGTTCGGCGCATGCGTATCTTACCTAGTTGGCAGTCCCTTCTAGGTAATAGTCTGGTCGGCAGTCCCGTCCAGACTACAGCTCGGTTGGCAGTCCCATCCGATGCGTCATCTGGTTGGCAGTCCCTTCCAGATGACTTGATGTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

62

Amino Acids

6.97

Weight (kDa)

11.79

Isoelectric Point (pI)

83.79

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AluBI AGCT 1 cut(s) 125
AluI AGCT 1 cut(s) 125
AoxI GGCC 1 cut(s) 41
AspLEI GCGC 1 cut(s) 54
BccI CCATC 1 cut(s) 148
BfaI CTAG 2 cut(s) 69, 86
BfmI CTRYAG 1 cut(s) 120
BglI GCCNNNNNGGC 1 cut(s) 49
BmsI GCATC 1 cut(s) 136
Bse1I ACTGG 1 cut(s) 44
BseGI GGATG 1 cut(s) 140
BseNI ACTGG 1 cut(s) 44
BshFI GGCC 1 cut(s) 43
BslFI GGGAC 4 cut(s) 64, 93, 122, 151
BsmFI GGGAC 4 cut(s) 64, 93, 122, 151
BsnI GGCC 1 cut(s) 43
BspANI GGCC 1 cut(s) 43
BsrI ACTGG 1 cut(s) 44
Bst4CI ACNGT 1 cut(s) 30
BstC8I GCNNGC 1 cut(s) 56
BstF5I GGATG 1 cut(s) 140
BstHHI GCGC 1 cut(s) 54
BstMWI GCNNNNNNNGC 2 cut(s) 49, 131
BstNSI RCATGY 1 cut(s) 58
BstSFI CTRYAG 1 cut(s) 120
BsuRI GGCC 1 cut(s) 43
BtsCI GGATG 1 cut(s) 140
Cac8I GCNNGC 1 cut(s) 56
CfoI GCGC 1 cut(s) 54
CseI GACGC 1 cut(s) 138
CviAII CATG 1 cut(s) 55
CviJI RGCY 2 cut(s) 43, 125
CviKI_1 RGCY 2 cut(s) 43, 125
FaeI CATG 1 cut(s) 58
FaiI YATR 1 cut(s) 56
FaqI GGGAC 4 cut(s) 64, 93, 122, 151
FatI CATG 1 cut(s) 54
FokI GGATG 1 cut(s) 127
FspBI CTAG 2 cut(s) 69, 86
GlaI GCGC 1 cut(s) 53
HaeIII GGCC 1 cut(s) 43
HgaI GACGC 1 cut(s) 138
HhaI GCGC 1 cut(s) 54
Hin1II CATG 1 cut(s) 58
Hin6I GCGC 1 cut(s) 52
HinP1I GCGC 1 cut(s) 52
HincII GTYRAC 1 cut(s) 33
HindII GTYRAC 1 cut(s) 33
Hpy166II GTNNAC 1 cut(s) 33
Hpy188I TCNGA 1 cut(s) 145
Hpy188III TCNNGA 2 cut(s) 115, 173
Hpy8I GTNNAC 1 cut(s) 33
HpyAV CCTTC 2 cut(s) 92, 179
HpyCH4III ACNGT 1 cut(s) 30
HpyF10VI GCNNNNNNNGC 2 cut(s) 49, 131
Hsp92II CATG 1 cut(s) 58
HspAI GCGC 1 cut(s) 52
LpnPI CCDG 4 cut(s) 57, 83, 128, 141
LweI GCATC 1 cut(s) 136
MaeI CTAG 2 cut(s) 69, 86
MnlI CCTC 1 cut(s) 33
MseI TTAA 1 cut(s) 17
MwoI GCNNNNNNNGC 2 cut(s) 49, 131
NlaIII CATG 1 cut(s) 58
NspI RCATGY 1 cut(s) 58
PaeI GCATGC 1 cut(s) 58
PcsI WCGNNNNNNNCGW 2 cut(s) 55, 108
SaqAI TTAA 1 cut(s) 17
SetI ASST 3 cut(s) 70, 91, 127
SfaNI GCATC 1 cut(s) 136
SfcI CTRYAG 1 cut(s) 120
SphI GCATGC 1 cut(s) 58
SspMI CTAG 2 cut(s) 69, 86
TaaI ACNGT 1 cut(s) 30
Tru1I TTAA 1 cut(s) 17
Tru9I TTAA 1 cut(s) 17
XceI RCATGY 1 cut(s) 58
XspI CTAG 2 cut(s) 69, 86
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.