Rroxscaffold_6G00398440

No description available

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000006
Physical Location & Seq
Forward (+)
20333223 .. 20336374
3152 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_6G00398440.1

Sequence Viewer

Length: 204 bp
ATGCCCTTTAAGGTTTTTGATATGAGTTCTTCGCGCCTCAATCAATGGAGTCCGAGCAAAGAGATTTATGTTCTCGATGTGGAGTATCCGGTCATTTGGCACATATTTTTAGAGCTTATGGAGAAATTTTCACCGCATACAAAGCATATTGTGAAGCAAGGGAAGCTCACGATGTGGAATAAGAAGATCAAGAAGATGATCTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

67

Amino Acids

8.14

Weight (kDa)

9.7

Isoelectric Point (pI)

77.78

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 1 cut(s) 34
AciI CCGC 1 cut(s) 134
AcsI RAATTY 1 cut(s) 125
AdeI CACNNNGTG 1 cut(s) 174
AluBI AGCT 2 cut(s) 115, 166
AluI AGCT 2 cut(s) 115, 166
ApoI RAATTY 1 cut(s) 125
AspLEI GCGC 1 cut(s) 36
AsuHPI GGTGA 1 cut(s) 123
BciVI GTATCC 1 cut(s) 96
BfaI CTAG 1 cut(s) 202
BfuI GTATCC 1 cut(s) 96
BsaWI WCCGGW 1 cut(s) 88
Bsh1236I CGCG 1 cut(s) 34
BsiSI CCGG 1 cut(s) 89
Bsp143I GATC 2 cut(s) 186, 198
BspACI CCGC 1 cut(s) 134
BspFNI CGCG 1 cut(s) 34
BssMI GATC 2 cut(s) 186, 198
BstFNI CGCG 1 cut(s) 34
BstHHI GCGC 1 cut(s) 36
BstKTI GATC 2 cut(s) 189, 201
BstMBI GATC 2 cut(s) 186, 198
BstMWI GCNNNNNNNGC 2 cut(s) 142, 163
BstUI CGCG 1 cut(s) 34
BsuI GTATCC 1 cut(s) 96
CfoI GCGC 1 cut(s) 36
CviJI RGCY 2 cut(s) 115, 166
CviKI_1 RGCY 2 cut(s) 115, 166
DpnI GATC 2 cut(s) 188, 200
DpnII GATC 2 cut(s) 186, 198
DraIII CACNNNGTG 1 cut(s) 174
FaiI YATR 6 cut(s) 23, 69, 104, 119, 138, 147
FspBI CTAG 1 cut(s) 202
GlaI GCGC 1 cut(s) 35
HapII CCGG 1 cut(s) 89
HhaI GCGC 1 cut(s) 36
Hin6I GCGC 1 cut(s) 34
HinP1I GCGC 1 cut(s) 34
HinfI GANTC 1 cut(s) 49
HpaII CCGG 1 cut(s) 89
HphI GGTGA 1 cut(s) 123
Hpy188I TCNGA 1 cut(s) 54
Hpy188III TCNNGA 3 cut(s) 74, 169, 190
HpyF10VI GCNNNNNNNGC 2 cut(s) 142, 163
HspAI GCGC 1 cut(s) 34
Kzo9I GATC 2 cut(s) 186, 198
LpnPI CCDG 1 cut(s) 102
MaeI CTAG 1 cut(s) 202
MalI GATC 2 cut(s) 188, 200
MboI GATC 2 cut(s) 186, 198
MboII GAAGA 2 cut(s) 21, 196
MluCI AATT 1 cut(s) 125
MlyI GAGTC 1 cut(s) 58
MnlI CCTC 1 cut(s) 47
MseI TTAA 1 cut(s) 9
MspI CCGG 1 cut(s) 89
MvnI CGCG 1 cut(s) 34
MwoI GCNNNNNNNGC 2 cut(s) 142, 163
NdeII GATC 2 cut(s) 186, 198
PleI GAGTC 1 cut(s) 57
PpsI GAGTC 1 cut(s) 57
SaqAI TTAA 1 cut(s) 9
Sau3AI GATC 2 cut(s) 186, 198
SchI GAGTC 1 cut(s) 58
SetI ASST 3 cut(s) 15, 117, 168
SgeI CNNG 6 cut(s) 45, 66, 86, 101, 170, 181
Sse9I AATT 1 cut(s) 125
SsiI CCGC 1 cut(s) 134
SspMI CTAG 1 cut(s) 202
TaqI TCGA 1 cut(s) 75
TasI AATT 1 cut(s) 125
Tru1I TTAA 1 cut(s) 9
Tru9I TTAA 1 cut(s) 9
XapI RAATTY 1 cut(s) 125
XspI CTAG 1 cut(s) 202
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.