Basic Information

Type: gene

Biological Identity

Species

rosa_samantha

Chromosome

Chr6A

Orthogroup ID

OG0016988

Physical Location & Seq

Genomic Coordinates Forward (+)

9393791 .. 9394045

Gene Structure 255 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rh6AG063500.1

Sequence Viewer

CDS Protein Promoter (2k)

Length: 255 bp

ATGGAAAGCGAGAGGGAGGTAACACCTCTGGCCATGTTGGTGGCGCCACCAACACTAAGAGCCATCGAATTGACGCTTTCAAAGCGCCTCAATCAATGGAGTTTGAGCAAAGAGATGTATGTTCTCGCTGTGGAGTGTCTGATCATTGAGCACACATTTGTAGAGCTCGTGAAGAACTTGTCACCGCCTACAAAGCATATTGTGAAGCAACAGAAGCTCACTATGTGGAACAAGAAGATCAAGAAGATGATCTAG

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

No domains found.

Protein Analysis

84

Amino Acids

9.79

Weight (kDa)

9.61

Isoelectric Point (pI)

65.1

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0016988)

Species	Orthologous Gene IDs
rosa_chinensis	RchiOBHm_Chr2g0120861 RchiOBHm_Chr6g0286981
rosa_multiflora	Rmu_sc0000621.1_g000013 Rmu_sc0001336.1_g000024 Rmu_sc0003286.1_g000011
rosa_roxburghii	Rroxscaffold_1G00046530 Rroxscaffold_3G00267300 Rroxscaffold_6G00397470 Rroxscaffold_6G00398440
rosa_samantha	Rh2BG189800 Rh2BG214300 Rh3BG126400 Rh6AG063500 Rh7CG162900

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccB1I	GGYRCC	1 cut(s)	43
AciI	CCGC	1 cut(s)	185
AcoI	YGGCCR	1 cut(s)	30
AcyI	GRCGYC	1 cut(s)	44
AdeI	CACNNNGTG	1 cut(s)	225
AgsI	TTSAA	1 cut(s)	81
AluBI	AGCT	2 cut(s)	166, 217
AluI	AGCT	2 cut(s)	166, 217
Alw21I	GWGCWC	2 cut(s)	153, 168
AoxI	GGCC	1 cut(s)	30
AspLEI	GCGC	2 cut(s)	46, 87
AsuHPI	GGTGA	1 cut(s)	174
BalI	TGGCCA	1 cut(s)	32
BanI	GGYRCC	1 cut(s)	43
BanII	GRGCYC	1 cut(s)	168
BauI	CACGAG	1 cut(s)	167
Bbv12I	GWGCWC	2 cut(s)	153, 168
BccI	CCATC	1 cut(s)	71
BclI	TGATCA	1 cut(s)	141
BfaI	CTAG	1 cut(s)	253
BfoI	RGCGCY	2 cut(s)	47, 88
BmiI	GGNNCC	1 cut(s)	45
BsaHI	GRCGYC	1 cut(s)	44
BshFI	GGCC	1 cut(s)	32
BshNI	GGYRCC	1 cut(s)	43
BsiHKAI	GWGCWC	2 cut(s)	153, 168
BsnI	GGCC	1 cut(s)	32
Bsp1286I	GDGCHC	2 cut(s)	153, 168
Bsp143I	GATC	3 cut(s)	141, 237, 249
BspACI	CCGC	1 cut(s)	185
BspANI	GGCC	1 cut(s)	32
BspLI	GGNNCC	1 cut(s)	45
BspT107I	GGYRCC	1 cut(s)	43
BssMI	GATC	3 cut(s)	141, 237, 249
BssNI	GRCGYC	1 cut(s)	44
BssSI	CACGAG	1 cut(s)	167
Bst2BI	CACGAG	1 cut(s)	167
BstACI	GRCGYC	1 cut(s)	44
BstDEI	CTNAG	1 cut(s)	56
BstH2I	RGCGCY	2 cut(s)	47, 88
BstHHI	GCGC	2 cut(s)	46, 87
BstKTI	GATC	3 cut(s)	144, 240, 252
BstMBI	GATC	3 cut(s)	141, 237, 249
BstMWI	GCNNNNNNNGC	3 cut(s)	82, 193, 214
BstXI	CCANNNNNNTGG	1 cut(s)	40
BsuRI	GGCC	1 cut(s)	32
CfoI	GCGC	2 cut(s)	46, 87
CseI	GACGC	1 cut(s)	82
CviAII	CATG	1 cut(s)	34
CviJI	RGCY	4 cut(s)	32, 62, 166, 217
CviKI_1	RGCY	4 cut(s)	32, 62, 166, 217
DdeI	CTNAG	1 cut(s)	56
DinI	GGCGCC	1 cut(s)	45
DpnI	GATC	3 cut(s)	143, 239, 251
DpnII	GATC	3 cut(s)	141, 237, 249
DraIII	CACNNNGTG	1 cut(s)	225
EaeI	YGGCCR	1 cut(s)	30
Ecl136II	GAGCTC	1 cut(s)	166
Eco24I	GRGCYC	1 cut(s)	168
Eco53kI	GAGCTC	1 cut(s)	166
EcoICRI	GAGCTC	1 cut(s)	166
EcoT38I	GRGCYC	1 cut(s)	168
EgeI	GGCGCC	1 cut(s)	45
EheI	GGCGCC	1 cut(s)	45
FaeI	CATG	1 cut(s)	37
FaiI	YATR	4 cut(s)	35, 120, 198, 224
FatI	CATG	1 cut(s)	33
FbaI	TGATCA	1 cut(s)	141
FriOI	GRGCYC	1 cut(s)	168
FspBI	CTAG	1 cut(s)	253
GlaI	GCGC	2 cut(s)	45, 86
HaeII	RGCGCY	2 cut(s)	47, 88
HaeIII	GGCC	1 cut(s)	32
HgaI	GACGC	1 cut(s)	82
HhaI	GCGC	2 cut(s)	46, 87
Hin1I	GRCGYC	1 cut(s)	44
Hin1II	CATG	1 cut(s)	37
Hin6I	GCGC	2 cut(s)	44, 85
HinP1I	GCGC	2 cut(s)	44, 85
HphI	GGTGA	1 cut(s)	174
Hpy188I	TCNGA	1 cut(s)	141
Hpy188III	TCNNGA	2 cut(s)	169, 241
HpyF10VI	GCNNNNNNNGC	3 cut(s)	82, 193, 214
HpyF3I	CTNAG	1 cut(s)	56
Hsp92I	GRCGYC	1 cut(s)	44
Hsp92II	CATG	1 cut(s)	37
HspAI	GCGC	2 cut(s)	44, 85
KasI	GGCGCC	1 cut(s)	43
Ksp22I	TGATCA	1 cut(s)	141
Kzo9I	GATC	3 cut(s)	141, 237, 249
LpnPI	CCDG	1 cut(s)	14
MaeI	CTAG	1 cut(s)	253
MaeIII	GTNAC	2 cut(s)	19, 180
MalI	GATC	3 cut(s)	143, 239, 251
MboI	GATC	3 cut(s)	141, 237, 249
MboII	GAAGA	2 cut(s)	184, 247
MhlI	GDGCHC	2 cut(s)	153, 168
MlsI	TGGCCA	1 cut(s)	32
MluCI	AATT	1 cut(s)	68
MluNI	TGGCCA	1 cut(s)	32
Mly113I	GGCGCC	1 cut(s)	44
MnlI	CCTC	4 cut(s)	6, 10, 36, 98
Mox20I	TGGCCA	1 cut(s)	32
MscI	TGGCCA	1 cut(s)	32
MslI	CAYNNNNRTG	1 cut(s)	38
Msp20I	TGGCCA	1 cut(s)	32
MwoI	GCNNNNNNNGC	3 cut(s)	82, 193, 214
NarI	GGCGCC	1 cut(s)	44
NdeII	GATC	3 cut(s)	141, 237, 249
NlaIII	CATG	1 cut(s)	37
NlaIV	GGNNCC	1 cut(s)	45
NmuCI	GTSAC	1 cut(s)	180
PluTI	GGCGCC	1 cut(s)	47
Psp124BI	GAGCTC	1 cut(s)	168
PspN4I	GGNNCC	1 cut(s)	45
RseI	CAYNNNNRTG	1 cut(s)	38
SacI	GAGCTC	1 cut(s)	168
Sau3AI	GATC	3 cut(s)	141, 237, 249
SduI	GDGCHC	2 cut(s)	153, 168
SetI	ASST	4 cut(s)	21, 28, 168, 219
SfoI	GGCGCC	1 cut(s)	45
SgeI	CNNG	8 cut(s)	22, 41, 46, 137, 179, 181, 190, 244
SmiMI	CAYNNNNRTG	1 cut(s)	38
Sse9I	AATT	1 cut(s)	68
SsiI	CCGC	1 cut(s)	185
SspDI	GGCGCC	1 cut(s)	43
SspMI	CTAG	1 cut(s)	253
SstI	GAGCTC	1 cut(s)	168
TaqI	TCGA	1 cut(s)	66
TasI	AATT	1 cut(s)	68
TseFI	GTSAC	1 cut(s)	180
Tsp45I	GTSAC	1 cut(s)	180
XspI	CTAG	1 cut(s)	253

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.