Rroxscaffold_3G00267300

No description available

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000003
Physical Location & Seq
Reverse (-)
60382043 .. 60382977
935 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_3G00267300.1

Sequence Viewer

Length: 165 bp
ATGGAAAGAAATGGATTTAAAGAAAGGAATTGGCAAGGAGGCTATCTTTGGCGCATGCGTATATTACCTAGTTGGCAGTCTCTTCTAGGTAATATTTTGGTTTGCAGTCCCTTCCGGACCATATCCCGGTTGGTAGTCCCTTTTGATGAATCACCTGGTTGGTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

54

Amino Acids

6.43

Weight (kDa)

10.02

Isoelectric Point (pI)

78.25

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccIII TCCGGA 1 cut(s) 114
AfiI CCNNNNNNNGG 1 cut(s) 126
AjnI CCWGG 1 cut(s) 154
Alw26I GTCTC 1 cut(s) 84
Aor13HI TCCGGA 1 cut(s) 114
AspLEI GCGC 1 cut(s) 54
AspS9I GGNCC 1 cut(s) 117
AsuC2I CCSGG 1 cut(s) 127
AsuHPI GGTGA 1 cut(s) 144
AvaII GGWCC 1 cut(s) 117
BciT130I CCWGG 1 cut(s) 156
BcnI CCSGG 1 cut(s) 127
BcoDI GTCTC 1 cut(s) 84
BfaI CTAG 2 cut(s) 69, 86
Bme1390I CCNGG 2 cut(s) 127, 156
Bme18I GGWCC 1 cut(s) 117
BmgT120I GGNCC 1 cut(s) 117
BmrFI CCNGG 2 cut(s) 127, 156
BpuMI CCSGG 1 cut(s) 127
BsaWI WCCGGW 1 cut(s) 114
Bsc4I CCNNNNNNNGG 1 cut(s) 126
BseAI TCCGGA 1 cut(s) 114
BseBI CCWGG 1 cut(s) 156
BseLI CCNNNNNNNGG 1 cut(s) 126
BsiSI CCGG 2 cut(s) 115, 127
BslFI GGGAC 2 cut(s) 93, 122
BslI CCNNNNNNNGG 1 cut(s) 126
BsmAI GTCTC 1 cut(s) 84
BsmFI GGGAC 2 cut(s) 93, 122
Bsp13I TCCGGA 1 cut(s) 114
BspEI TCCGGA 1 cut(s) 114
Bst2UI CCWGG 1 cut(s) 156
Bst6I CTCTTC 1 cut(s) 87
BstC8I GCNNGC 1 cut(s) 56
BstHHI GCGC 1 cut(s) 54
BstMAI GTCTC 1 cut(s) 84
BstNI CCWGG 1 cut(s) 156
BstNSI RCATGY 1 cut(s) 58
BstSCI CCNGG 2 cut(s) 125, 154
Cac8I GCNNGC 1 cut(s) 56
CfoI GCGC 1 cut(s) 54
Cfr13I GGNCC 1 cut(s) 117
CsiI ACCWGGT 1 cut(s) 154
CviAII CATG 1 cut(s) 55
CviJI RGCY 1 cut(s) 42
CviKI_1 RGCY 1 cut(s) 42
DraI TTTAAA 1 cut(s) 19
Eam1104I CTCTTC 1 cut(s) 87
EarI CTCTTC 1 cut(s) 87
Eco47I GGWCC 1 cut(s) 117
EcoRII CCWGG 1 cut(s) 154
FaeI CATG 1 cut(s) 58
FaiI YATR 3 cut(s) 56, 62, 122
FaqI GGGAC 2 cut(s) 93, 122
FatI CATG 1 cut(s) 54
FspBI CTAG 2 cut(s) 69, 86
GlaI GCGC 1 cut(s) 53
HapII CCGG 2 cut(s) 115, 127
HhaI GCGC 1 cut(s) 54
Hin1II CATG 1 cut(s) 58
Hin6I GCGC 1 cut(s) 52
HinP1I GCGC 1 cut(s) 52
HinfI GANTC 1 cut(s) 149
HpaII CCGG 2 cut(s) 115, 127
HphI GGTGA 1 cut(s) 144
Hpy188III TCNNGA 1 cut(s) 115
HpyAV CCTTC 1 cut(s) 121
HpyCH4V TGCA 1 cut(s) 105
Hsp92II CATG 1 cut(s) 58
HspAI GCGC 1 cut(s) 52
Kpn2I TCCGGA 1 cut(s) 114
LpnPI CCDG 3 cut(s) 128, 140, 141
MabI ACCWGGT 1 cut(s) 154
MaeI CTAG 2 cut(s) 69, 86
MboII GAAGA 1 cut(s) 74
MluCI AATT 1 cut(s) 28
MnlI CCTC 1 cut(s) 32
MroI TCCGGA 1 cut(s) 114
MseI TTAA 1 cut(s) 18
MspI CCGG 2 cut(s) 115, 127
MspR9I CCNGG 2 cut(s) 127, 156
MvaI CCWGG 1 cut(s) 156
NciI CCSGG 1 cut(s) 127
NlaIII CATG 1 cut(s) 58
NspI RCATGY 1 cut(s) 58
PaeI GCATGC 1 cut(s) 58
PfeI GAWTC 1 cut(s) 149
Psp6I CCWGG 1 cut(s) 154
PspGI CCWGG 1 cut(s) 154
PspPI GGNCC 1 cut(s) 117
SaqAI TTAA 1 cut(s) 18
Sau96I GGNCC 1 cut(s) 117
ScrFI CCNGG 2 cut(s) 127, 156
SetI ASST 3 cut(s) 70, 91, 157
SexAI ACCWGGT 1 cut(s) 154
SgeI CNNG 7 cut(s) 47, 67, 81, 98, 127, 138, 139
SinI GGWCC 1 cut(s) 117
SphI GCATGC 1 cut(s) 58
Sse9I AATT 1 cut(s) 28
SspI AATATT 1 cut(s) 94
SspMI CTAG 2 cut(s) 69, 86
StyD4I CCNGG 2 cut(s) 125, 154
TasI AATT 1 cut(s) 28
TfiI GAWTC 1 cut(s) 149
Tru1I TTAA 1 cut(s) 18
Tru9I TTAA 1 cut(s) 18
TspDTI ATGAA 1 cut(s) 162
VpaK11BI GGWCC 1 cut(s) 117
XceI RCATGY 1 cut(s) 58
XcmI CCANNNNNNNNNTGG 1 cut(s) 127
XspI CTAG 2 cut(s) 69, 86
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.