Basic Information

Type: gene

Biological Identity

Species

rosa_chinensis

Chromosome

Orthogroup ID

OG0018183

Physical Location & Seq

Genomic Coordinates Reverse (-)

36248306 .. 36248521

Gene Structure 216 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

PRQ19535

Sequence Viewer

CDS Protein Promoter (2k)

Length: 216 bp

ATGAACATGATTCTAAATTTGTATGCATTATGTTGGGAAATTAGGGATGCACGATTGATGTTTGATAAAATGTTGCAGAGGGATGTTGTCATGTGGAATATAGTGATGACTCTGTTGATGAAGAGAGGTGATATAGAGGAAGCTTATGATTTGATTTCGGGGATGCCAGATAGAAGTGTGAGGTCATGGACGCTGATGATTTCGGGGTTTGGTTAG

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

DYW_deaminase PPR PPR_2

Protein Analysis

71

Amino Acids

8.41

Weight (kDa)

5.13

Isoelectric Point (pI)

69.84

Instability Index

Protein Domains (Pfam)

Domain Name	Pfam ID	Position	E-value	Description
PPR_2	PF13041	27 - 69	8.5e-08	PPR repeat family

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0018183)

Species	Orthologous Gene IDs
rosa_chinensis	RchiOBHm_Chr4g0437811 RchiOBHm_Chr7g0218241
rosa_laevigata	RLG00000002387 RLG00000009748 RLG00000015083
rosa_multiflora	Rmu_sc0002510.1_g000030 Rmu_sc0004956.1_g000002 Rmu_sc0035370.1_g000002 Rmu_sc0041118.1_g000001
rosa_rugosa	Rorug01G0424000
rosa_samantha	Rh7DG304200

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AcsI	RAATTY	1 cut(s)	16
AluBI	AGCT	1 cut(s)	143
AluI	AGCT	1 cut(s)	143
ApoI	RAATTY	1 cut(s)	16
AsuHPI	GGTGA	1 cut(s)	140
BmsI	GCATC	2 cut(s)	37, 153
BseGI	GGATG	3 cut(s)	52, 88, 168
Bst6I	CTCTTC	1 cut(s)	116
BstF5I	GGATG	3 cut(s)	52, 88, 168
BtsCI	GGATG	3 cut(s)	52, 88, 168
CseI	GACGC	1 cut(s)	199
CviAII	CATG	3 cut(s)	7, 91, 186
CviJI	RGCY	1 cut(s)	143
CviKI_1	RGCY	1 cut(s)	143
Eam1104I	CTCTTC	1 cut(s)	116
EarI	CTCTTC	1 cut(s)	116
EcoT22I	ATGCAT	1 cut(s)	28
FaeI	CATG	3 cut(s)	10, 94, 189
FaiI	YATR	8 cut(s)	8, 24, 31, 92, 101, 134, 147, 187
FatI	CATG	3 cut(s)	6, 90, 185
FokI	GGATG	3 cut(s)	59, 95, 175
HgaI	GACGC	1 cut(s)	199
Hin1II	CATG	3 cut(s)	10, 94, 189
HindIII	AAGCTT	1 cut(s)	141
HinfI	GANTC	2 cut(s)	10, 109
HphI	GGTGA	1 cut(s)	140
HpyCH4V	TGCA	3 cut(s)	26, 50, 76
Hsp92II	CATG	3 cut(s)	10, 94, 189
LpnPI	CCDG	1 cut(s)	180
LweI	GCATC	2 cut(s)	37, 153
MboII	GAAGA	1 cut(s)	133
MluCI	AATT	2 cut(s)	16, 39
MlyI	GAGTC	1 cut(s)	103
MnlI	CCTC	4 cut(s)	72, 119, 130, 174
Mph1103I	ATGCAT	1 cut(s)	28
NlaIII	CATG	3 cut(s)	10, 94, 189
NsiI	ATGCAT	1 cut(s)	28
PfeI	GAWTC	1 cut(s)	10
PleI	GAGTC	1 cut(s)	103
PpsI	GAGTC	1 cut(s)	103
SchI	GAGTC	1 cut(s)	103
SetI	ASST	3 cut(s)	130, 145, 185
SfaNI	GCATC	2 cut(s)	37, 153
SgeI	CNNG	6 cut(s)	19, 63, 103, 171, 179, 198
Sse9I	AATT	2 cut(s)	16, 39
TasI	AATT	2 cut(s)	16, 39
TfiI	GAWTC	1 cut(s)	10
TspDTI	ATGAA	2 cut(s)	17, 134
XapI	RAATTY	1 cut(s)	16
Zsp2I	ATGCAT	1 cut(s)	28

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.