Rmu_sc0041118.1_g000001

Pentatricopeptide repeat-containing protein

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0041118.1
Physical Location & Seq
Forward (+)
110 .. 674
565 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0041118.1_g000001.1.cds

Sequence Viewer

Length: 318 bp
atgctcaagtctggaatttcgatggaggcggtgggacgacttagattggaagtttggaggtatttgtcgattcatattgatgctagtaagaggctgggatgttggtttgtcagcagatcaaggttggttttgaaggccaccacgggggatgcacgattgatgcttgataaaatgttgcagagggatgttgtcatgtggaatatagtgatgactctgttgatgaagagaggtgatatagaggaagcttatgatttgatttcggggatgccagatagaagtgtgaggtcatggacgctgatgatttcggggtttggttag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

105

Amino Acids

12.08

Weight (kDa)

9.88

Isoelectric Point (pI)

56.76

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 29
AcsI RAATTY 1 cut(s) 15
AfiI CCNNNNNNNGG 1 cut(s) 144
AgsI TTSAA 1 cut(s) 133
AluBI AGCT 1 cut(s) 245
AluI AGCT 1 cut(s) 245
AoxI GGCC 1 cut(s) 135
ApoI RAATTY 1 cut(s) 15
AsuHPI GGTGA 1 cut(s) 242
BccI CCATC 1 cut(s) 16
BfaI CTAG 1 cut(s) 84
BmsI GCATC 4 cut(s) 70, 139, 150, 255
BsaJI CCNNGG 1 cut(s) 141
Bsc4I CCNNNNNNNGG 1 cut(s) 144
BseDI CCNNGG 1 cut(s) 141
BseGI GGATG 4 cut(s) 104, 154, 190, 270
BseLI CCNNNNNNNGG 1 cut(s) 144
BseYI CCCAGC 1 cut(s) 94
BshFI GGCC 1 cut(s) 137
BslFI GGGAC 1 cut(s) 48
BslI CCNNNNNNNGG 1 cut(s) 144
BsmFI GGGAC 1 cut(s) 48
BsnI GGCC 1 cut(s) 137
Bsp143I GATC 1 cut(s) 116
BspACI CCGC 1 cut(s) 29
BspANI GGCC 1 cut(s) 137
BssECI CCNNGG 1 cut(s) 141
BssMI GATC 1 cut(s) 116
Bst6I CTCTTC 1 cut(s) 218
BstDEI CTNAG 1 cut(s) 41
BstDSI CCRYGG 1 cut(s) 141
BstF5I GGATG 4 cut(s) 104, 154, 190, 270
BstKTI GATC 1 cut(s) 119
BstMBI GATC 1 cut(s) 116
BsuRI GGCC 1 cut(s) 137
BtgI CCRYGG 1 cut(s) 141
BtsCI GGATG 4 cut(s) 104, 154, 190, 270
CseI GACGC 1 cut(s) 301
CviAII CATG 2 cut(s) 193, 288
CviJI RGCY 3 cut(s) 94, 137, 245
CviKI_1 RGCY 3 cut(s) 94, 137, 245
DdeI CTNAG 1 cut(s) 41
DpnI GATC 1 cut(s) 118
DpnII GATC 1 cut(s) 116
Eam1104I CTCTTC 1 cut(s) 218
EarI CTCTTC 1 cut(s) 218
FaeI CATG 2 cut(s) 196, 291
FaiI YATR 6 cut(s) 75, 194, 203, 236, 249, 289
FaqI GGGAC 1 cut(s) 48
FatI CATG 2 cut(s) 192, 287
FokI GGATG 4 cut(s) 111, 161, 197, 277
FspBI CTAG 1 cut(s) 84
GsaI CCCAGC 1 cut(s) 98
HaeIII GGCC 1 cut(s) 137
HgaI GACGC 1 cut(s) 301
Hin1II CATG 2 cut(s) 196, 291
HindIII AAGCTT 1 cut(s) 243
HinfI GANTC 2 cut(s) 70, 211
HphI GGTGA 1 cut(s) 242
Hpy188III TCNNGA 1 cut(s) 12
HpyAV CCTTC 1 cut(s) 127
HpyCH4V TGCA 2 cut(s) 152, 178
HpyF3I CTNAG 1 cut(s) 41
Hsp92II CATG 2 cut(s) 196, 291
Kzo9I GATC 1 cut(s) 116
LpnPI CCDG 2 cut(s) 80, 282
LweI GCATC 4 cut(s) 70, 139, 150, 255
MaeI CTAG 1 cut(s) 84
MalI GATC 1 cut(s) 118
MboI GATC 1 cut(s) 116
MboII GAAGA 1 cut(s) 235
MluCI AATT 1 cut(s) 15
MlyI GAGTC 1 cut(s) 205
MnlI CCTC 7 cut(s) 19, 51, 84, 174, 221, 232, 276
MslI CAYNNNNRTG 1 cut(s) 78
NdeII GATC 1 cut(s) 116
NlaIII CATG 2 cut(s) 196, 291
PfeI GAWTC 1 cut(s) 70
PleI GAGTC 1 cut(s) 205
PpsI GAGTC 1 cut(s) 205
PspFI CCCAGC 1 cut(s) 94
RseI CAYNNNNRTG 1 cut(s) 78
Sau3AI GATC 1 cut(s) 116
SchI GAGTC 1 cut(s) 205
SetI ASST 5 cut(s) 62, 125, 232, 247, 287
SfaNI GCATC 4 cut(s) 70, 139, 150, 255
SmiMI CAYNNNNRTG 1 cut(s) 78
SmlI CTYRAG 1 cut(s) 5
SmoI CTYRAG 1 cut(s) 5
Sse9I AATT 1 cut(s) 15
SsiI CCGC 1 cut(s) 29
SspMI CTAG 1 cut(s) 84
TaqI TCGA 2 cut(s) 20, 68
TasI AATT 1 cut(s) 15
TfiI GAWTC 1 cut(s) 70
TspDTI ATGAA 2 cut(s) 62, 236
XapI RAATTY 1 cut(s) 15
XspI CTAG 1 cut(s) 84
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.