Rh7DG304200

Pentatricopeptide repeat-containing protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr7D
OG0018183
Physical Location & Seq
Forward (+)
35213195 .. 35213870
676 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh7DG304200.1

Sequence Viewer

Length: 342 bp
ATGGGGTTGGACAATGAGGAGGATGAAACACATGTGGAACTCCAAGGAGGTGGTCCGTCGAGCGATGCTGGCCAGCCATGGCAGCATATTTCAACCCCGACGACGCTAACAATGCTCAAGTCTGGAATTTCGATGGAGGCGGTGGCACGACTTAGATTGGAAGTTTGGAGGGATGCACGATTGGTGCTTGATAAAATGTTGCAGAGGGATGTTGCCATGTGGAATATAGTGATGACTCTGTTGATGAAGAGAGGTGATATAGAGGAAGCTTATGATTTGATTTCGGGGATGCCAGATAGAAGTGTGAGGTTATGGACGCTGATGATTTCGGGGTTTGGTTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
DYW_deaminase PPR PPR_2

Protein Analysis

113

Amino Acids

12.72

Weight (kDa)

4.77

Isoelectric Point (pI)

55.72

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
PPR_2 PF13041 69 - 102 4.7e-06 PPR repeat family
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 140
AcoI YGGCCR 1 cut(s) 70
AcsI RAATTY 1 cut(s) 126
AflIII ACRYGT 1 cut(s) 31
AgsI TTSAA 1 cut(s) 93
AluBI AGCT 1 cut(s) 269
AluI AGCT 1 cut(s) 269
AoxI GGCC 1 cut(s) 70
ApeKI GCWGC 1 cut(s) 82
ApoI RAATTY 1 cut(s) 126
AspS9I GGNCC 1 cut(s) 53
AsuHPI GGTGA 1 cut(s) 266
AvaII GGWCC 1 cut(s) 53
BalI TGGCCA 1 cut(s) 72
BbvI GCAGC 1 cut(s) 94
BccI CCATC 1 cut(s) 127
BisI GCNGC 1 cut(s) 83
BlsI GCNGC 1 cut(s) 84
Bme18I GGWCC 1 cut(s) 53
BmgT120I GGNCC 1 cut(s) 53
BmsI GCATC 3 cut(s) 55, 163, 279
BpuEI CTTGAG 1 cut(s) 101
BsaJI CCNNGG 2 cut(s) 43, 77
BseDI CCNNGG 2 cut(s) 43, 77
BseGI GGATG 4 cut(s) 28, 178, 214, 294
BseRI GAGGAG 1 cut(s) 32
BseXI GCAGC 1 cut(s) 94
BshFI GGCC 1 cut(s) 72
BsnI GGCC 1 cut(s) 72
Bsp19I CCATGG 1 cut(s) 77
BspACI CCGC 1 cut(s) 140
BspANI GGCC 1 cut(s) 72
BssECI CCNNGG 2 cut(s) 43, 77
BssT1I CCWWGG 2 cut(s) 43, 77
Bst6I CTCTTC 1 cut(s) 242
BstC8I GCNNGC 2 cut(s) 70, 74
BstDEI CTNAG 1 cut(s) 152
BstDSI CCRYGG 1 cut(s) 77
BstF5I GGATG 4 cut(s) 28, 178, 214, 294
BstMWI GCNNNNNNNGC 3 cut(s) 69, 82, 112
BstNSI RCATGY 1 cut(s) 35
BstV1I GCAGC 1 cut(s) 94
BstXI CCANNNNNNTGG 1 cut(s) 50
BsuRI GGCC 1 cut(s) 72
BtgI CCRYGG 1 cut(s) 77
BtgZI GCGATG 1 cut(s) 78
BtsCI GGATG 4 cut(s) 28, 178, 214, 294
Cac8I GCNNGC 2 cut(s) 70, 74
Cfr13I GGNCC 1 cut(s) 53
CseI GACGC 2 cut(s) 112, 325
CviAII CATG 3 cut(s) 32, 78, 217
CviJI RGCY 3 cut(s) 72, 76, 269
CviKI_1 RGCY 3 cut(s) 72, 76, 269
DdeI CTNAG 1 cut(s) 152
EaeI YGGCCR 1 cut(s) 70
Eam1104I CTCTTC 1 cut(s) 242
EarI CTCTTC 1 cut(s) 242
Eco130I CCWWGG 2 cut(s) 43, 77
Eco47I GGWCC 1 cut(s) 53
EcoT14I CCWWGG 2 cut(s) 43, 77
ErhI CCWWGG 2 cut(s) 43, 77
FaeI CATG 3 cut(s) 35, 81, 220
FaiI YATR 8 cut(s) 33, 79, 87, 218, 227, 260, 273, 313
FatI CATG 3 cut(s) 31, 77, 216
Fnu4HI GCNGC 1 cut(s) 83
FokI GGATG 4 cut(s) 35, 185, 221, 301
Fsp4HI GCNGC 1 cut(s) 83
GluI GCNGC 1 cut(s) 83
HaeIII GGCC 1 cut(s) 72
HgaI GACGC 2 cut(s) 112, 325
Hin1II CATG 3 cut(s) 35, 81, 220
HindIII AAGCTT 1 cut(s) 267
HinfI GANTC 1 cut(s) 235
HphI GGTGA 1 cut(s) 266
Hpy188III TCNNGA 1 cut(s) 123
Hpy99I CGWCG 3 cut(s) 61, 103, 106
HpyCH4V TGCA 2 cut(s) 176, 202
HpyF10VI GCNNNNNNNGC 3 cut(s) 69, 82, 112
HpyF3I CTNAG 1 cut(s) 152
Hsp92II CATG 3 cut(s) 35, 81, 220
LpnPI CCDG 4 cut(s) 54, 86, 108, 306
Lsp1109I GCAGC 1 cut(s) 94
LweI GCATC 3 cut(s) 55, 163, 279
MboII GAAGA 1 cut(s) 259
MlsI TGGCCA 1 cut(s) 72
MluCI AATT 1 cut(s) 126
MluNI TGGCCA 1 cut(s) 72
MlyI GAGTC 1 cut(s) 229
MnlI CCTC 9 cut(s) 10, 13, 41, 130, 162, 198, 245, 256, 300
Mox20I TGGCCA 1 cut(s) 72
MscI TGGCCA 1 cut(s) 72
Msp20I TGGCCA 1 cut(s) 72
MwoI GCNNNNNNNGC 3 cut(s) 69, 82, 112
NcoI CCATGG 1 cut(s) 77
NlaIII CATG 3 cut(s) 35, 81, 220
NspI RCATGY 1 cut(s) 35
PciI ACATGT 1 cut(s) 31
PkrI GCNGC 1 cut(s) 84
PleI GAGTC 1 cut(s) 229
PpsI GAGTC 1 cut(s) 229
PscI ACATGT 1 cut(s) 31
PspPI GGNCC 1 cut(s) 53
SatI GCNGC 1 cut(s) 83
Sau96I GGNCC 1 cut(s) 53
SchI GAGTC 1 cut(s) 229
SetI ASST 4 cut(s) 52, 256, 271, 311
SfaNI GCATC 3 cut(s) 55, 163, 279
SinI GGWCC 1 cut(s) 53
SmlI CTYRAG 1 cut(s) 116
SmoI CTYRAG 1 cut(s) 116
Sse9I AATT 1 cut(s) 126
SsiI CCGC 1 cut(s) 140
StyI CCWWGG 2 cut(s) 43, 77
TaqI TCGA 2 cut(s) 59, 131
TasI AATT 1 cut(s) 126
TseI GCWGC 1 cut(s) 82
TspDTI ATGAA 2 cut(s) 39, 260
TspGWI ACGGA 1 cut(s) 45
VpaK11BI GGWCC 1 cut(s) 53
XapI RAATTY 1 cut(s) 126
XceI RCATGY 1 cut(s) 35
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.