RchiOBHm_Chr7g0225061

External alternative NAD(P)H-ubiquinone oxidoreductase

Basic Information

Type: gene
Biological Identity
rosa_chinensis
7
Physical Location & Seq
Forward (+)
47491378 .. 47492428
1051 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ20155

Sequence Viewer

Length: 351 bp
ATGCTGGCTTGGTTTCTAGAATCTAGGTCTTACTGTAAAAAGATTGTCTTTCAATTCACCGAAGCTGAGTGTCTCAAGATTGATGTAAAAGAGAAGAAAGTCTATTGCCAATCTAATTTAGAGAATGGGGAAAAAGAAATTTTAGTGGACTACGACTACCTTGTAATATTTGTGGGAGCAAATGTTAATACATTCAATACTCCTGGTGTGATGGAGAACTGCCATTTCTTGAAGGAAGTAGAAGATGCCCAGAAGATACGAAGAACTGTTATTGAATGCTTTGAAAAGGCTAGCCTGCCAACTATAAATGATGAGGAGAAGGAGAAAATTCTTCATTTTGCCGTTGTTTGA

Protein Analysis

116

Amino Acids

13.55

Weight (kDa)

5.09

Isoelectric Point (pI)

41.2

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Pyr_redox_2 PF07992 16 - 90 1.5e-09 Pyridine nucleotide-disulphide oxidoreductase
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 2 cut(s) 138, 327
AgsI TTSAA 5 cut(s) 53, 196, 232, 275, 284
AjnI CCWGG 1 cut(s) 202
AluBI AGCT 1 cut(s) 65
AluI AGCT 1 cut(s) 65
Alw26I GTCTC 1 cut(s) 77
ApoI RAATTY 2 cut(s) 138, 327
AsuHPI GGTGA 1 cut(s) 49
AsuNHI GCTAGC 1 cut(s) 290
BccI CCATC 1 cut(s) 205
BceAI ACGGC 1 cut(s) 326
BciT130I CCWGG 1 cut(s) 204
BcoDI GTCTC 1 cut(s) 77
BfaI CTAG 3 cut(s) 17, 24, 291
Bme1390I CCNGG 1 cut(s) 204
BmrFI CCNGG 1 cut(s) 204
BmsI GCATC 1 cut(s) 235
BmtI GCTAGC 1 cut(s) 294
BpuEI CTTGAG 1 cut(s) 59
BsaXI ACNNNNNCTCC 2 cut(s) 168, 198
BseBI CCWGG 1 cut(s) 204
BseMII CTCAG 1 cut(s) 57
BseRI GAGGAG 1 cut(s) 329
BsmAI GTCTC 1 cut(s) 77
BsmI GAATGC 1 cut(s) 281
BspCNI CTCAG 1 cut(s) 58
BspOI GCTAGC 1 cut(s) 294
Bst2UI CCWGG 1 cut(s) 204
Bst4CI ACNGT 2 cut(s) 35, 268
BstC8I GCNNGC 3 cut(s) 6, 292, 296
BstDEI CTNAG 1 cut(s) 66
BstMAI GTCTC 1 cut(s) 77
BstNI CCWGG 1 cut(s) 204
BstSCI CCNGG 1 cut(s) 202
Cac8I GCNNGC 3 cut(s) 6, 292, 296
CviJI RGCY 4 cut(s) 8, 65, 290, 294
CviKI_1 RGCY 4 cut(s) 8, 65, 290, 294
DdeI CTNAG 1 cut(s) 66
EcoRII CCWGG 1 cut(s) 202
FaiI YATR 1 cut(s) 305
FalI AAGNNNNNCTT 2 cut(s) 32, 64
FspBI CTAG 3 cut(s) 17, 24, 291
HinfI GANTC 1 cut(s) 20
HphI GGTGA 1 cut(s) 49
Hpy166II GTNNAC 1 cut(s) 148
Hpy188III TCNNGA 3 cut(s) 17, 76, 229
Hpy8I GTNNAC 1 cut(s) 148
HpyAV CCTTC 2 cut(s) 226, 313
HpyCH4III ACNGT 2 cut(s) 35, 268
HpyF3I CTNAG 1 cut(s) 66
LmnI GCTCC 1 cut(s) 176
LpnPI CCDG 4 cut(s) 189, 216, 263, 308
LweI GCATC 1 cut(s) 235
MaeI CTAG 3 cut(s) 17, 24, 291
MboII GAAGA 5 cut(s) 106, 254, 265, 273, 323
MluCI AATT 4 cut(s) 53, 115, 138, 327
MnlI CCTC 1 cut(s) 307
MseI TTAA 1 cut(s) 186
MspR9I CCNGG 1 cut(s) 204
Mva1269I GAATGC 1 cut(s) 281
MvaI CCWGG 1 cut(s) 204
NheI GCTAGC 1 cut(s) 290
PctI GAATGC 1 cut(s) 281
PfeI GAWTC 1 cut(s) 20
Psp6I CCWGG 1 cut(s) 202
PspGI CCWGG 1 cut(s) 202
SaqAI TTAA 1 cut(s) 186
ScrFI CCNGG 1 cut(s) 204
SetI ASST 3 cut(s) 29, 67, 162
SfaNI GCATC 1 cut(s) 235
SmlI CTYRAG 1 cut(s) 74
SmoI CTYRAG 1 cut(s) 74
Sse9I AATT 4 cut(s) 53, 115, 138, 327
SspI AATATT 1 cut(s) 168
SspMI CTAG 3 cut(s) 17, 24, 291
StyD4I CCNGG 1 cut(s) 202
TaaI ACNGT 2 cut(s) 35, 268
TasI AATT 4 cut(s) 53, 115, 138, 327
TfiI GAWTC 1 cut(s) 20
Tru1I TTAA 1 cut(s) 186
Tru9I TTAA 1 cut(s) 186
TspDTI ATGAA 1 cut(s) 323
XapI RAATTY 2 cut(s) 138, 327
XbaI TCTAGA 1 cut(s) 16
XspI CTAG 3 cut(s) 17, 24, 291
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.