RchiOBHm_Chr7g0227281

G-type lectin S-receptor-like serine threonine-protein kinase

Basic Information

Type: gene
Biological Identity
rosa_chinensis
7
Physical Location & Seq
Forward (+)
50579625 .. 50579876
252 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ20356

Sequence Viewer

Length: 252 bp
ATGGAACTAGCTGACCCAAGGTTAGAGGGTCGTGTGAGCAGTGAGGAGGTTGAGAAGCTAGTGAGGGTAGCCTTGTGTTGCGTGCATGTAGGGCCAACACTGAGGCCAAGTATGACCAATGTGGTTGCTATGTTGGAAGGCAGATTACCTATAGCTGAGACTAGGATTGAAGCATTAGAATTCTTGCGGTCCTACGGTGGTAATGTTTCAGAGGCATCCAGCAAGCTAACAAAAGTGGGATCTGCAGAATAA

Protein Analysis

83

Amino Acids

8.99

Weight (kDa)

5.43

Isoelectric Point (pI)

34.61

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 187
AclWI GGATC 1 cut(s) 247
AcsI RAATTY 1 cut(s) 179
AgsI TTSAA 1 cut(s) 170
AluBI AGCT 4 cut(s) 11, 58, 155, 226
AluI AGCT 4 cut(s) 11, 58, 155, 226
Alw26I GTCTC 1 cut(s) 152
AlwI GGATC 1 cut(s) 247
AoxI GGCC 2 cut(s) 92, 104
ApoI RAATTY 1 cut(s) 179
AspS9I GGNCC 2 cut(s) 92, 189
AvaII GGWCC 1 cut(s) 189
BarI GAAGNNNNNNTAC 2 cut(s) 129, 161
BcoDI GTCTC 1 cut(s) 152
BfaI CTAG 3 cut(s) 8, 59, 162
BfmI CTRYAG 2 cut(s) 150, 243
Bme18I GGWCC 1 cut(s) 189
BmgT120I GGNCC 2 cut(s) 92, 189
BmsI GCATC 1 cut(s) 224
BsaJI CCNNGG 1 cut(s) 17
BseDI CCNNGG 1 cut(s) 17
BseGI GGATG 1 cut(s) 215
BseMII CTCAG 2 cut(s) 92, 147
BseRI GAGGAG 1 cut(s) 59
BshFI GGCC 2 cut(s) 94, 106
BsmAI GTCTC 1 cut(s) 152
BsnI GGCC 2 cut(s) 94, 106
Bsp143I GATC 1 cut(s) 239
BspACI CCGC 1 cut(s) 187
BspANI GGCC 2 cut(s) 94, 106
BspCNI CTCAG 2 cut(s) 93, 148
BspMAI CTGCAG 1 cut(s) 247
BspPI GGATC 1 cut(s) 247
BssECI CCNNGG 1 cut(s) 17
BssMI GATC 1 cut(s) 239
BssT1I CCWWGG 1 cut(s) 17
Bst4CI ACNGT 1 cut(s) 197
BstC8I GCNNGC 2 cut(s) 83, 224
BstDEI CTNAG 2 cut(s) 101, 156
BstF5I GGATG 1 cut(s) 215
BstKTI GATC 1 cut(s) 242
BstMAI GTCTC 1 cut(s) 152
BstMBI GATC 1 cut(s) 239
BstMWI GCNNNNNNNGC 1 cut(s) 91
BstNSI RCATGY 1 cut(s) 89
BstSFI CTRYAG 2 cut(s) 150, 243
BstX2I RGATCY 1 cut(s) 239
BstYI RGATCY 1 cut(s) 239
BsuRI GGCC 2 cut(s) 94, 106
BtsCI GGATG 1 cut(s) 215
BtsI GCAGTG 1 cut(s) 46
BtsIMutI CAGTG 2 cut(s) 46, 98
Cac8I GCNNGC 2 cut(s) 83, 224
Cfr13I GGNCC 2 cut(s) 92, 189
CviAII CATG 1 cut(s) 86
CviJI RGCY 7 cut(s) 11, 58, 71, 94, 106, 155, 226
CviKI_1 RGCY 7 cut(s) 11, 58, 71, 94, 106, 155, 226
DdeI CTNAG 2 cut(s) 101, 156
DpnI GATC 1 cut(s) 241
DpnII GATC 1 cut(s) 239
Eco130I CCWWGG 1 cut(s) 17
Eco47I GGWCC 1 cut(s) 189
EcoRI GAATTC 1 cut(s) 179
EcoT14I CCWWGG 1 cut(s) 17
ErhI CCWWGG 1 cut(s) 17
FaeI CATG 1 cut(s) 89
FaiI YATR 4 cut(s) 87, 113, 131, 152
FatI CATG 1 cut(s) 85
FokI GGATG 1 cut(s) 202
FspBI CTAG 3 cut(s) 8, 59, 162
HaeIII GGCC 2 cut(s) 94, 106
Hin1II CATG 1 cut(s) 89
Hpy188I TCNGA 1 cut(s) 211
HpyAV CCTTC 1 cut(s) 131
HpyCH4III ACNGT 1 cut(s) 197
HpyCH4V TGCA 2 cut(s) 85, 245
HpyF10VI GCNNNNNNNGC 1 cut(s) 91
HpyF3I CTNAG 2 cut(s) 101, 156
Hsp92II CATG 1 cut(s) 89
Kzo9I GATC 1 cut(s) 239
LpnPI CCDG 1 cut(s) 232
LweI GCATC 1 cut(s) 224
MaeI CTAG 3 cut(s) 8, 59, 162
MalI GATC 1 cut(s) 241
MboI GATC 1 cut(s) 239
MflI RGATCY 1 cut(s) 239
MluCI AATT 1 cut(s) 179
MmeI TCCRAC 1 cut(s) 114
MnlI CCTC 6 cut(s) 19, 37, 40, 57, 96, 205
MwoI GCNNNNNNNGC 1 cut(s) 91
NdeII GATC 1 cut(s) 239
NlaIII CATG 1 cut(s) 89
NspI RCATGY 1 cut(s) 89
PspPI GGNCC 2 cut(s) 92, 189
PstI CTGCAG 1 cut(s) 247
PsuI RGATCY 1 cut(s) 239
Sau3AI GATC 1 cut(s) 239
Sau96I GGNCC 2 cut(s) 92, 189
SetI ASST 7 cut(s) 13, 23, 51, 60, 151, 157, 228
SfaNI GCATC 1 cut(s) 224
SfcI CTRYAG 2 cut(s) 150, 243
SinI GGWCC 1 cut(s) 189
Sse9I AATT 1 cut(s) 179
SsiI CCGC 1 cut(s) 187
SspMI CTAG 3 cut(s) 8, 59, 162
StyI CCWWGG 1 cut(s) 17
TaaI ACNGT 1 cut(s) 197
TasI AATT 1 cut(s) 179
TscAI CASTG 2 cut(s) 46, 105
TspRI CASTG 2 cut(s) 46, 105
VpaK11BI GGWCC 1 cut(s) 189
XapI RAATTY 1 cut(s) 179
XceI RCATGY 1 cut(s) 89
XspI CTAG 3 cut(s) 8, 59, 162
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.