Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_ssc0000177.1

Orthogroup ID

OG0016426

Physical Location & Seq

Genomic Coordinates Reverse (-)

29480 .. 30235

Gene Structure 756 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_ssc0000177.1_g000003.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 756 bp

atgaatagaggttcattggagaaggttctgtttggcaatggccctgttttggattgggaaaagagatatgggatagtacttggaatggcaagggggcttgcttacttgcacagtggatgcaatcctaagatagtccactgtgacatcaaaccggaaaacatacttctgcatgatgatttacaagtgaagatatcagactttggggtttccaagtttataagttacaaaaaatccaaactgttgacgacacttagaggaactcagggatatcttgcgtctaaatggcttactagctatggcattagtgaaaaaattgatgtatacagttatgggatggtgttgctagaattggtgaggggaagaagaaattgcttgtttcaaagtggtggcaccagaaatgatgacactgatggaaatgaaagatgtttcaatccaatcagttcggaagaaagaatggtgtacttcccacaacttgcactccaaatgcataagaaaatgaggtatatggaactagctgacccaaggttagagggtcgtgtgaggagtgaggaggttgagaagctagtgagggtagccttgtgttgtgtgcatgtagggccaacactgaggccaagtatgaccaatgtggttgctatgttggaaggcagattacctatagctgagcctaggattgaagcattagaattcttgcggtcctatggtggaaatgttttagaggcatccagcaagctaacaaaagtgggatgtgaagaataa

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0003674 GO:0003824 GO:0004672 GO:0004674 GO:0005488 GO:0005515 GO:0005516 GO:0005575 GO:0005623 GO:0005886 GO:0006464 GO:0006468 GO:0006793 GO:0006796 GO:0006807 GO:0008150 GO:0008152 GO:0009987 GO:0016020 GO:0016301 GO:0016310 GO:0016740 GO:0016772 GO:0016773 GO:0019538 GO:0036211 GO:0043170 GO:0043412 GO:0044237 GO:0044238 GO:0044260 GO:0044267 GO:0044464 GO:0071704 GO:0071944 GO:0140096 GO:1901564

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

B_lectin Pkinase S_locus_glycop Transgly

Protein Analysis

251

Amino Acids

28.32

Weight (kDa)

8.77

Isoelectric Point (pI)

36.39

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0016426)

Species	Orthologous Gene IDs
rosa_chinensis	RchiOBHm_Chr1g0342671 RchiOBHm_Chr7g0227281 RchiOBHm_Chr7g0227411
rosa_laevigata	RLG00000001733 RLG00000001735 RLG00000001737 RLG00000001739 RLG00000001742
rosa_multiflora	Rmu_sc0000173.1_g000007 Rmu_sc0003542.1_g000012 Rmu_ssc0000177.1_g000003
rosa_roxburghii	Rroxscaffold_3G00233220
rosa_samantha	Rh7AG391300 Rh7CG410300 Rh7CG468800

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AanI	TTATAA	1 cut(s)	218
AccB1I	GGYRCC	1 cut(s)	389
AccI	GTMKAC	1 cut(s)	321
AciI	CCGC	1 cut(s)	691
AcsI	RAATTY	1 cut(s)	683
AfaI	GTAC	2 cut(s)	78, 461
AfiI	CCNNNNNNNGG	1 cut(s)	49
AgsI	TTSAA	3 cut(s)	380, 430, 674
AluBI	AGCT	5 cut(s)	294, 515, 562, 659, 730
AluI	AGCT	5 cut(s)	294, 515, 562, 659, 730
AoxI	GGCC	3 cut(s)	40, 596, 608
ApoI	RAATTY	1 cut(s)	683
AspA2I	CCTAGG	1 cut(s)	665
AspS9I	GGNCC	3 cut(s)	41, 596, 693
AsuHPI	GGTGA	1 cut(s)	364
AvaII	GGWCC	1 cut(s)	693
AvrII	CCTAGG	1 cut(s)	665
BanI	GGYRCC	1 cut(s)	389
BarI	GAAGNNNNNNTAC	2 cut(s)	633, 665
BccI	CCATC	2 cut(s)	328, 404
BfaI	CTAG	5 cut(s)	291, 344, 512, 563, 666
BfmI	CTRYAG	1 cut(s)	654
BlnI	CCTAGG	1 cut(s)	665
BlpI	GCTNAGC	1 cut(s)	660
BmcAI	AGTACT	1 cut(s)	78
Bme18I	GGWCC	1 cut(s)	693
BmgT120I	GGNCC	3 cut(s)	41, 596, 693
BmiI	GGNNCC	1 cut(s)	391
BmsI	GCATC	2 cut(s)	107, 728
Bpu1102I	GCTNAGC	1 cut(s)	660
BsaJI	CCNNGG	2 cut(s)	521, 665
BsaWI	WCCGGW	1 cut(s)	151
BsaXI	ACNNNNNCTCC	2 cut(s)	462, 492
Bsc4I	CCNNNNNNNGG	1 cut(s)	49
Bse3DI	GCAATG	1 cut(s)	43
BseDI	CCNNGG	2 cut(s)	521, 665
BseGI	GGATG	4 cut(s)	122, 339, 719, 749
BseLI	CCNNNNNNNGG	1 cut(s)	49
BseMI	GCAATG	1 cut(s)	43
BseMII	CTCAG	3 cut(s)	275, 596, 651
BseRI	GAGGAG	2 cut(s)	556, 563
BshFI	GGCC	3 cut(s)	42, 598, 610
BshNI	GGYRCC	1 cut(s)	389
BsiSI	CCGG	1 cut(s)	152
BslI	CCNNNNNNNGG	1 cut(s)	49
BsnI	GGCC	3 cut(s)	42, 598, 610
Bsp1720I	GCTNAGC	1 cut(s)	660
BspACI	CCGC	1 cut(s)	691
BspANI	GGCC	3 cut(s)	42, 598, 610
BspCNI	CTCAG	3 cut(s)	274, 597, 652
BspLI	GGNNCC	1 cut(s)	391
BspT107I	GGYRCC	1 cut(s)	389
BsrDI	GCAATG	1 cut(s)	43
BssECI	CCNNGG	2 cut(s)	521, 665
BssNAI	GTATAC	1 cut(s)	322
BssT1I	CCWWGG	2 cut(s)	521, 665
Bst1107I	GTATAC	1 cut(s)	322
Bst4CI	ACNGT	4 cut(s)	113, 140, 240, 326
BstC8I	GCNNGC	2 cut(s)	99, 728
BstDEI	CTNAG	5 cut(s)	126, 251, 261, 605, 660
BstF5I	GGATG	4 cut(s)	122, 339, 719, 749
BstMWI	GCNNNNNNNGC	1 cut(s)	595
BstNSI	RCATGY	1 cut(s)	593
BstSFI	CTRYAG	1 cut(s)	654
BstZ17I	GTATAC	1 cut(s)	322
BsuRI	GGCC	3 cut(s)	42, 598, 610
BtsCI	GGATG	4 cut(s)	122, 339, 719, 749
BtsIMutI	CAGTG	4 cut(s)	118, 136, 405, 602
Cac8I	GCNNGC	2 cut(s)	99, 728
Cfr13I	GGNCC	3 cut(s)	41, 596, 693
CseI	GACGC	1 cut(s)	264
Csp6I	GTAC	2 cut(s)	77, 460
CviAII	CATG	2 cut(s)	170, 590
CviQI	GTAC	2 cut(s)	77, 460
DdeI	CTNAG	5 cut(s)	126, 251, 261, 605, 660
Eco130I	CCWWGG	2 cut(s)	521, 665
Eco32I	GATATC	2 cut(s)	192, 269
Eco47I	GGWCC	1 cut(s)	693
EcoRI	GAATTC	1 cut(s)	683
EcoRV	GATATC	2 cut(s)	192, 269
EcoT14I	CCWWGG	2 cut(s)	521, 665
EcoT22I	ATGCAT	1 cut(s)	489
ErhI	CCWWGG	2 cut(s)	521, 665
FaeI	CATG	2 cut(s)	173, 593
FatI	CATG	2 cut(s)	169, 589
FblI	GTMKAC	1 cut(s)	321
FokI	GGATG	3 cut(s)	129, 346, 706
FspBI	CTAG	5 cut(s)	291, 344, 512, 563, 666
HaeIII	GGCC	3 cut(s)	42, 598, 610
HapII	CCGG	1 cut(s)	152
HgaI	GACGC	1 cut(s)	264
Hin1II	CATG	2 cut(s)	173, 593
HincII	GTYRAC	1 cut(s)	243
HindII	GTYRAC	1 cut(s)	243
HpaII	CCGG	1 cut(s)	152
HphI	GGTGA	1 cut(s)	364
Hpy166II	GTNNAC	4 cut(s)	136, 243, 322, 460
Hpy188I	TCNGA	2 cut(s)	196, 445
Hpy8I	GTNNAC	4 cut(s)	136, 243, 322, 460
HpyAV	CCTTC	2 cut(s)	16, 635
HpyCH4III	ACNGT	4 cut(s)	113, 140, 240, 326
HpyCH4V	TGCA	6 cut(s)	109, 120, 169, 476, 487, 589
HpyF10VI	GCNNNNNNNGC	1 cut(s)	595
HpyF3I	CTNAG	5 cut(s)	126, 251, 261, 605, 660
Hsp92II	CATG	2 cut(s)	173, 593
LpnPI	CCDG	5 cut(s)	57, 165, 248, 406, 736
LweI	GCATC	2 cut(s)	107, 728
MaeI	CTAG	5 cut(s)	291, 344, 512, 563, 666
MaeIII	GTNAC	2 cut(s)	140, 221
MboII	GAAGA	4 cut(s)	199, 372, 375, 458
MluCI	AATT	4 cut(s)	312, 347, 367, 683
MmeI	TCCRAC	1 cut(s)	618
Mph1103I	ATGCAT	1 cut(s)	489
MspI	CCGG	1 cut(s)	152
MwoI	GCNNNNNNNGC	1 cut(s)	595
NlaIII	CATG	2 cut(s)	173, 593
NlaIV	GGNNCC	1 cut(s)	391
NmuCI	GTSAC	1 cut(s)	140
NsiI	ATGCAT	1 cut(s)	489
NspI	RCATGY	1 cut(s)	593
PsiI	TTATAA	1 cut(s)	218
PspN4I	GGNNCC	1 cut(s)	391
PspPI	GGNCC	3 cut(s)	41, 596, 693
RsaI	GTAC	2 cut(s)	78, 461
RsaNI	GTAC	2 cut(s)	77, 460
Sau96I	GGNCC	3 cut(s)	41, 596, 693
ScaI	AGTACT	1 cut(s)	78
SfaNI	GCATC	2 cut(s)	107, 728
SfcI	CTRYAG	1 cut(s)	654
SinI	GGWCC	1 cut(s)	693
Sse9I	AATT	4 cut(s)	312, 347, 367, 683
SsiI	CCGC	1 cut(s)	691
SspMI	CTAG	5 cut(s)	291, 344, 512, 563, 666
StyI	CCWWGG	2 cut(s)	521, 665
TaaI	ACNGT	4 cut(s)	113, 140, 240, 326
TasI	AATT	4 cut(s)	312, 347, 367, 683
TatI	WGTACW	2 cut(s)	76, 459
TscAI	CASTG	4 cut(s)	118, 143, 412, 609
TseFI	GTSAC	1 cut(s)	140
Tsp45I	GTSAC	1 cut(s)	140
TspDTI	ATGAA	2 cut(s)	17, 432
TspRI	CASTG	4 cut(s)	118, 143, 412, 609
VpaK11BI	GGWCC	1 cut(s)	693
XapI	RAATTY	1 cut(s)	683
XceI	RCATGY	1 cut(s)	593
XmaJI	CCTAGG	1 cut(s)	665
XmiI	GTMKAC	1 cut(s)	321
XspI	CTAG	5 cut(s)	291, 344, 512, 563, 666
ZrmI	AGTACT	1 cut(s)	78
Zsp2I	ATGCAT	1 cut(s)	489

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.