Rmu_sc0003542.1_g000012

G-type lectin S-receptor-like serine threonine-protein kinase

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0003542.1
Physical Location & Seq
Reverse (-)
47861 .. 48205
345 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0003542.1_g000012.1.cds

Sequence Viewer

Length: 345 bp
atgcacaagcagaagaggtatatggaactagcagacctgaggttagagggacaattgaggagtgaggaagttgagaagctagtgagtgtagccttgtgttgtgtgcatgtagtgccaccactgaagccatgtatgatcaatgtggttgctatgttggaaggcagattacctgtaggggatccccggactgaggcacttgaatttttatggttttatggtggaaaattcacccaagcatccagaaagcttgcaaggattgttcagttagggaagaagaaactcgttttcttatggcagatgactttacatacctctgattgtagtgaaattgcaaacactgtttga

Protein Analysis

114

Amino Acids

13.01

Weight (kDa)

9.0

Isoelectric Point (pI)

48.98

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 2 cut(s) 173, 186
AcsI RAATTY 2 cut(s) 200, 224
AcuI CTGAAG 1 cut(s) 143
AfiI CCNNNNNNNGG 1 cut(s) 190
AgsI TTSAA 1 cut(s) 200
AluBI AGCT 2 cut(s) 79, 247
AluI AGCT 2 cut(s) 79, 247
AlwI GGATC 2 cut(s) 173, 186
ApoI RAATTY 2 cut(s) 200, 224
AsuC2I CCSGG 1 cut(s) 184
AsuHPI GGTGA 1 cut(s) 220
AxyI CCTNAGG 1 cut(s) 38
BamHI GGATCC 1 cut(s) 178
BarI GAAGNNNNNNTAC 2 cut(s) 150, 182
BclI TGATCA 1 cut(s) 135
BcnI CCSGG 1 cut(s) 184
BfaI CTAG 2 cut(s) 29, 80
BfmI CTRYAG 1 cut(s) 171
Bme1390I CCNGG 1 cut(s) 184
BmiI GGNNCC 1 cut(s) 180
BmrFI CCNGG 1 cut(s) 184
BmsI GCATC 1 cut(s) 245
BpuMI CCSGG 1 cut(s) 184
BsaJI CCNNGG 1 cut(s) 182
Bsc4I CCNNNNNNNGG 1 cut(s) 190
Bse21I CCTNAGG 1 cut(s) 38
BseDI CCNNGG 1 cut(s) 182
BseGI GGATG 1 cut(s) 236
BseLI CCNNNNNNNGG 1 cut(s) 190
BseMII CTCAG 2 cut(s) 29, 180
BseRI GAGGAG 1 cut(s) 73
BsiSI CCGG 1 cut(s) 184
BslFI GGGAC 1 cut(s) 63
BslI CCNNNNNNNGG 1 cut(s) 190
BsmFI GGGAC 1 cut(s) 63
Bsp143I GATC 2 cut(s) 135, 178
BspCNI CTCAG 2 cut(s) 30, 181
BspLI GGNNCC 1 cut(s) 180
BspPI GGATC 2 cut(s) 173, 186
BssECI CCNNGG 1 cut(s) 182
BssMI GATC 2 cut(s) 135, 178
Bst4CI ACNGT 1 cut(s) 340
Bst6I CTCTTC 1 cut(s) 8
BstAPI GCANNNNNTGC 1 cut(s) 112
BstC8I GCNNGC 1 cut(s) 249
BstDEI CTNAG 2 cut(s) 38, 189
BstF5I GGATG 1 cut(s) 236
BstKTI GATC 2 cut(s) 138, 181
BstMBI GATC 2 cut(s) 135, 178
BstMWI GCNNNNNNNGC 1 cut(s) 112
BstNSI RCATGY 1 cut(s) 110
BstSCI CCNGG 1 cut(s) 182
BstSFI CTRYAG 1 cut(s) 171
BstX2I RGATCY 1 cut(s) 178
BstYI RGATCY 1 cut(s) 178
Bsu36I CCTNAGG 1 cut(s) 38
BtsCI GGATG 1 cut(s) 236
BtsIMutI CAGTG 2 cut(s) 119, 336
Cac8I GCNNGC 1 cut(s) 249
CviAII CATG 2 cut(s) 107, 129
CviJI RGCY 4 cut(s) 79, 92, 127, 247
CviKI_1 RGCY 4 cut(s) 79, 92, 127, 247
DdeI CTNAG 2 cut(s) 38, 189
DpnI GATC 2 cut(s) 137, 180
DpnII GATC 2 cut(s) 135, 178
Eam1104I CTCTTC 1 cut(s) 8
EarI CTCTTC 1 cut(s) 8
Eco57I CTGAAG 1 cut(s) 143
Eco81I CCTNAGG 1 cut(s) 38
FaeI CATG 2 cut(s) 110, 132
FaqI GGGAC 1 cut(s) 63
FatI CATG 2 cut(s) 106, 128
FbaI TGATCA 1 cut(s) 135
FokI GGATG 1 cut(s) 223
FspBI CTAG 2 cut(s) 29, 80
HapII CCGG 1 cut(s) 184
Hin1II CATG 2 cut(s) 110, 132
HindIII AAGCTT 1 cut(s) 245
HpaII CCGG 1 cut(s) 184
HphI GGTGA 1 cut(s) 220
Hpy188I TCNGA 1 cut(s) 316
Hpy188III TCNNGA 1 cut(s) 240
HpyAV CCTTC 1 cut(s) 152
HpyCH4III ACNGT 1 cut(s) 340
HpyCH4V TGCA 4 cut(s) 4, 106, 251, 332
HpyF10VI GCNNNNNNNGC 1 cut(s) 112
HpyF3I CTNAG 2 cut(s) 38, 189
Hsp92II CATG 2 cut(s) 110, 132
Ksp22I TGATCA 1 cut(s) 135
Kzo9I GATC 2 cut(s) 135, 178
LpnPI CCDG 4 cut(s) 50, 183, 197, 253
LweI GCATC 1 cut(s) 245
MaeI CTAG 2 cut(s) 29, 80
MalI GATC 2 cut(s) 137, 180
MboI GATC 2 cut(s) 135, 178
MboII GAAGA 3 cut(s) 25, 283, 286
MfeI CAATTG 1 cut(s) 53
MflI RGATCY 1 cut(s) 178
MluCI AATT 4 cut(s) 53, 200, 224, 327
MmeI TCCRAC 1 cut(s) 135
MnlI CCTC 7 cut(s) 9, 33, 40, 51, 58, 184, 322
MspI CCGG 1 cut(s) 184
MspR9I CCNGG 1 cut(s) 184
MunI CAATTG 1 cut(s) 53
MwoI GCNNNNNNNGC 1 cut(s) 112
NciI CCSGG 1 cut(s) 184
NdeII GATC 2 cut(s) 135, 178
NlaIII CATG 2 cut(s) 110, 132
NlaIV GGNNCC 1 cut(s) 180
NspI RCATGY 1 cut(s) 110
PspN4I GGNNCC 1 cut(s) 180
PsuI RGATCY 1 cut(s) 178
Sau3AI GATC 2 cut(s) 135, 178
ScrFI CCNGG 1 cut(s) 184
SetI ASST 7 cut(s) 20, 39, 44, 81, 172, 249, 314
SfaNI GCATC 1 cut(s) 245
SfcI CTRYAG 1 cut(s) 171
Sse9I AATT 4 cut(s) 53, 200, 224, 327
SspMI CTAG 2 cut(s) 29, 80
StyD4I CCNGG 1 cut(s) 182
TaaI ACNGT 1 cut(s) 340
TasI AATT 4 cut(s) 53, 200, 224, 327
TscAI CASTG 2 cut(s) 126, 343
TspRI CASTG 2 cut(s) 126, 343
XapI RAATTY 2 cut(s) 200, 224
XceI RCATGY 1 cut(s) 110
XspI CTAG 2 cut(s) 29, 80
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.