Rmu_sc0000173.1_g000007

G-type lectin S-receptor-like serine threonine-protein kinase

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0000173.1
Physical Location & Seq
Forward (+)
38186 .. 38608
423 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0000173.1_g000007.1.cds

Sequence Viewer

Length: 423 bp
atggtgttgctagaattggtgaggggaagaagaaattgcttgtttcaaagtggtggcaccagaaatgatgacactgatggaaatgacagatgtttcaatccaatcaatttggaagaaagaatggtgtacttcccacaacttgcactccaaatgcataagaaaatgaggtatatggaactagctgacccaaggttagagggtcgtgtgaggagtgaggaggttgagaagctagtgagggtagccttgtgttgtgtgcatgtagggccaacactgaggccaagtatgaccaatgtggttgctatgttggaaggcagattacctatagctgagcctaggattgaagcattagaattcttgcggtcctatggtggaaatgtttcagaggcatccagcaagctaacaaaagtgggatgtgaagaataa

Protein Analysis

140

Amino Acids

15.9

Weight (kDa)

6.74

Isoelectric Point (pI)

53.97

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 56
AciI CCGC 1 cut(s) 358
AcsI RAATTY 1 cut(s) 350
AfaI GTAC 1 cut(s) 128
AgsI TTSAA 3 cut(s) 47, 97, 341
AluBI AGCT 4 cut(s) 182, 229, 326, 397
AluI AGCT 4 cut(s) 182, 229, 326, 397
AoxI GGCC 2 cut(s) 263, 275
ApoI RAATTY 1 cut(s) 350
Asp700I GAANNNNTTC 1 cut(s) 376
AspA2I CCTAGG 1 cut(s) 332
AspS9I GGNCC 2 cut(s) 263, 360
AsuHPI GGTGA 1 cut(s) 31
AvaII GGWCC 1 cut(s) 360
AvrII CCTAGG 1 cut(s) 332
BanI GGYRCC 1 cut(s) 56
BarI GAAGNNNNNNTAC 2 cut(s) 300, 332
BccI CCATC 1 cut(s) 71
BfaI CTAG 4 cut(s) 11, 179, 230, 333
BfmI CTRYAG 1 cut(s) 321
BlnI CCTAGG 1 cut(s) 332
BlpI GCTNAGC 1 cut(s) 327
Bme18I GGWCC 1 cut(s) 360
BmgT120I GGNCC 2 cut(s) 263, 360
BmiI GGNNCC 1 cut(s) 58
BmsI GCATC 1 cut(s) 395
Bpu1102I GCTNAGC 1 cut(s) 327
BsaJI CCNNGG 2 cut(s) 188, 332
BsaXI ACNNNNNCTCC 2 cut(s) 129, 159
BseDI CCNNGG 2 cut(s) 188, 332
BseGI GGATG 2 cut(s) 386, 416
BseMII CTCAG 2 cut(s) 263, 318
BseRI GAGGAG 2 cut(s) 223, 230
BshFI GGCC 2 cut(s) 265, 277
BshNI GGYRCC 1 cut(s) 56
BsnI GGCC 2 cut(s) 265, 277
Bsp1720I GCTNAGC 1 cut(s) 327
BspACI CCGC 1 cut(s) 358
BspANI GGCC 2 cut(s) 265, 277
BspCNI CTCAG 2 cut(s) 264, 319
BspLI GGNNCC 1 cut(s) 58
BspT107I GGYRCC 1 cut(s) 56
BssECI CCNNGG 2 cut(s) 188, 332
BssT1I CCWWGG 2 cut(s) 188, 332
BstC8I GCNNGC 1 cut(s) 395
BstDEI CTNAG 2 cut(s) 272, 327
BstF5I GGATG 2 cut(s) 386, 416
BstMWI GCNNNNNNNGC 1 cut(s) 262
BstNSI RCATGY 1 cut(s) 260
BstSFI CTRYAG 1 cut(s) 321
BsuRI GGCC 2 cut(s) 265, 277
BtsCI GGATG 2 cut(s) 386, 416
BtsIMutI CAGTG 2 cut(s) 72, 269
Cac8I GCNNGC 1 cut(s) 395
Cfr13I GGNCC 2 cut(s) 263, 360
Csp6I GTAC 1 cut(s) 127
CviAII CATG 1 cut(s) 257
CviJI RGCY 8 cut(s) 182, 229, 242, 265, 277, 326, 331, 397
CviKI_1 RGCY 8 cut(s) 182, 229, 242, 265, 277, 326, 331, 397
CviQI GTAC 1 cut(s) 127
DdeI CTNAG 2 cut(s) 272, 327
Eco130I CCWWGG 2 cut(s) 188, 332
Eco47I GGWCC 1 cut(s) 360
EcoRI GAATTC 1 cut(s) 350
EcoT14I CCWWGG 2 cut(s) 188, 332
EcoT22I ATGCAT 1 cut(s) 156
ErhI CCWWGG 2 cut(s) 188, 332
FaeI CATG 1 cut(s) 260
FaiI YATR 8 cut(s) 156, 171, 173, 258, 284, 302, 323, 366
FatI CATG 1 cut(s) 256
FokI GGATG 1 cut(s) 373
FspBI CTAG 4 cut(s) 11, 179, 230, 333
HaeIII GGCC 2 cut(s) 265, 277
Hin1II CATG 1 cut(s) 260
HphI GGTGA 1 cut(s) 31
Hpy166II GTNNAC 1 cut(s) 127
Hpy188I TCNGA 1 cut(s) 382
Hpy8I GTNNAC 1 cut(s) 127
HpyAV CCTTC 1 cut(s) 302
HpyCH4V TGCA 3 cut(s) 143, 154, 256
HpyF10VI GCNNNNNNNGC 1 cut(s) 262
HpyF3I CTNAG 2 cut(s) 272, 327
Hsp92II CATG 1 cut(s) 260
LpnPI CCDG 2 cut(s) 73, 403
LweI GCATC 1 cut(s) 395
MaeI CTAG 4 cut(s) 11, 179, 230, 333
MboII GAAGA 3 cut(s) 39, 42, 125
MluCI AATT 4 cut(s) 14, 34, 106, 350
MmeI TCCRAC 1 cut(s) 285
MnlI CCTC 9 cut(s) 15, 159, 190, 201, 208, 211, 228, 267, 376
Mph1103I ATGCAT 1 cut(s) 156
MroXI GAANNNNTTC 1 cut(s) 376
MwoI GCNNNNNNNGC 1 cut(s) 262
NlaIII CATG 1 cut(s) 260
NlaIV GGNNCC 1 cut(s) 58
NsiI ATGCAT 1 cut(s) 156
NspI RCATGY 1 cut(s) 260
PdmI GAANNNNTTC 1 cut(s) 376
PspN4I GGNNCC 1 cut(s) 58
PspPI GGNCC 2 cut(s) 263, 360
RsaI GTAC 1 cut(s) 128
RsaNI GTAC 1 cut(s) 127
Sau96I GGNCC 2 cut(s) 263, 360
SetI ASST 8 cut(s) 170, 184, 194, 222, 231, 322, 328, 399
SfaNI GCATC 1 cut(s) 395
SfcI CTRYAG 1 cut(s) 321
SinI GGWCC 1 cut(s) 360
Sse9I AATT 4 cut(s) 14, 34, 106, 350
SsiI CCGC 1 cut(s) 358
SspMI CTAG 4 cut(s) 11, 179, 230, 333
StyI CCWWGG 2 cut(s) 188, 332
TasI AATT 4 cut(s) 14, 34, 106, 350
TatI WGTACW 1 cut(s) 126
TscAI CASTG 2 cut(s) 79, 276
TspRI CASTG 2 cut(s) 79, 276
VpaK11BI GGWCC 1 cut(s) 360
XapI RAATTY 1 cut(s) 350
XceI RCATGY 1 cut(s) 260
XmaJI CCTAGG 1 cut(s) 332
XmnI GAANNNNTTC 1 cut(s) 376
XspI CTAG 4 cut(s) 11, 179, 230, 333
Zsp2I ATGCAT 1 cut(s) 156
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.