RchiOBHm_Chr7g0228531

transfer protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_chinensis
7
OG0018549
Physical Location & Seq
Forward (+)
51889390 .. 51890485
1096 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ20472

Sequence Viewer

Length: 438 bp
ATGAAAACTGTTGGTCAAGCAATTGACTACAGATGCCTTATCCGTGCAACTTATGGGAACAAGGCAATATCTTTTCACTACTATGTGCAGTCACACATTCAAATAAATGAATATCGAGATCGTGTTATTTTGCCCTTTGCATCGAAGAAGTATGGTAAACCTATCACCACGTGTGTGAAGGTTTTAGATATGACTGGGTTGAAGGTTTTAGCACTAAGCCAAATTAAGTTGTTGACAATTATATCAACAGTTGATGATTTGAACTACCCAGAGAAGACAAATACGTACTGCATTGTAAATGTGCCGTACATATTCTCAGCTTGTTGGAAGGTTGTCAAGCCCCTTTTGCAGGAGAGGATAAGGGAAAAGGTACAATTATTGTCTGGTTGTGGTACAGATGAGTTGTTGAAGGTAAGGTGTTTTTCCTGTGATGGTTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
CRAL_TRIO CRAL_TRIO_N

Protein Analysis

145

Amino Acids

16.55

Weight (kDa)

9.17

Isoelectric Point (pI)

25.72

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
CRAL_TRIO PF00650 53 - 136 1.1e-13 CRAL/TRIO domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0018549)

Species Orthologous Gene IDs
rosa_chinensis RchiOBHm_Chr1g0349911 RchiOBHm_Chr6g0293461 RchiOBHm_Chr7g0228531
rosa_laevigata RLG00000002912
rosa_roxburghii Rroxscaffold_7G00199770
rosa_samantha Rh1AG078400 Rh1CG122900 Rh5BG508100 Rh6CG161700 Rh6CG362500

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcvI CACGTG 1 cut(s) 171
AdeI CACNNNGTG 1 cut(s) 171
AfaI GTAC 4 cut(s) 287, 308, 372, 394
AfiI CCNNNNNNNGG 1 cut(s) 349
AflIII ACRYGT 1 cut(s) 170
AgsI TTSAA 4 cut(s) 101, 202, 262, 409
AleI CACNNNNGTG 1 cut(s) 173
AluBI AGCT 1 cut(s) 320
AluI AGCT 1 cut(s) 320
AsuHPI GGTGA 1 cut(s) 157
BbrPI CACGTG 1 cut(s) 171
BbsI GAAGAC 1 cut(s) 281
BccI CCATC 1 cut(s) 425
BceAI ACGGC 1 cut(s) 289
BfmI CTRYAG 1 cut(s) 28
BmrI ACTGGG 1 cut(s) 204
BmsI GCATC 2 cut(s) 23, 149
BmuI ACTGGG 1 cut(s) 204
BpiI GAAGAC 1 cut(s) 281
BsaAI YACGTR 2 cut(s) 171, 285
Bsc4I CCNNNNNNNGG 1 cut(s) 349
Bse1I ACTGG 1 cut(s) 199
BseLI CCNNNNNNNGG 1 cut(s) 349
BseMII CTCAG 1 cut(s) 330
BseNI ACTGG 1 cut(s) 199
BsgI GTGCAG 1 cut(s) 107
BslI CCNNNNNNNGG 1 cut(s) 349
Bsp143I GATC 1 cut(s) 118
BspCNI CTCAG 1 cut(s) 329
BsrI ACTGG 1 cut(s) 199
BssMI GATC 1 cut(s) 118
Bst4CI ACNGT 2 cut(s) 10, 250
BstBAI YACGTR 2 cut(s) 171, 285
BstDEI CTNAG 2 cut(s) 215, 316
BstENI CCTNNNNNAGG 1 cut(s) 347
BstKTI GATC 1 cut(s) 121
BstMBI GATC 1 cut(s) 118
BstMWI GCNNNNNNNGC 1 cut(s) 346
BstSFI CTRYAG 1 cut(s) 28
BstSNI TACGTA 1 cut(s) 285
BstV2I GAAGAC 1 cut(s) 281
Csp6I GTAC 4 cut(s) 286, 307, 371, 393
CviJI RGCY 3 cut(s) 219, 320, 340
CviKI_1 RGCY 3 cut(s) 219, 320, 340
CviQI GTAC 4 cut(s) 286, 307, 371, 393
DdeI CTNAG 2 cut(s) 215, 316
DpnI GATC 1 cut(s) 120
DpnII GATC 1 cut(s) 118
DraIII CACNNNGTG 1 cut(s) 171
Eco105I TACGTA 1 cut(s) 285
Eco72I CACGTG 1 cut(s) 171
EcoNI CCTNNNNNAGG 1 cut(s) 347
FaiI YATR 6 cut(s) 54, 84, 153, 191, 242, 311
HincII GTYRAC 1 cut(s) 234
HindII GTYRAC 1 cut(s) 234
HphI GGTGA 1 cut(s) 157
Hpy166II GTNNAC 2 cut(s) 158, 234
Hpy188III TCNNGA 1 cut(s) 116
Hpy8I GTNNAC 2 cut(s) 158, 234
HpyAV CCTTC 4 cut(s) 172, 196, 322, 403
HpyCH4III ACNGT 2 cut(s) 10, 250
HpyCH4IV ACGT 2 cut(s) 170, 284
HpyCH4V TGCA 5 cut(s) 47, 88, 140, 291, 349
HpyF10VI GCNNNNNNNGC 1 cut(s) 346
HpyF3I CTNAG 2 cut(s) 215, 316
HpySE526I ACGT 2 cut(s) 170, 284
Kzo9I GATC 1 cut(s) 118
LpnPI CCDG 4 cut(s) 180, 282, 335, 369
LweI GCATC 2 cut(s) 23, 149
MaeII ACGT 2 cut(s) 170, 284
MaeIII GTNAC 1 cut(s) 90
MalI GATC 1 cut(s) 120
MboI GATC 1 cut(s) 118
MboII GAAGA 2 cut(s) 157, 286
MfeI CAATTG 1 cut(s) 21
MluCI AATT 4 cut(s) 21, 222, 237, 374
MmeI TCCRAC 1 cut(s) 305
MnlI CCTC 1 cut(s) 348
MseI TTAA 1 cut(s) 225
MslI CAYNNNNRTG 2 cut(s) 81, 173
MunI CAATTG 1 cut(s) 21
MwoI GCNNNNNNNGC 1 cut(s) 346
NdeII GATC 1 cut(s) 118
NmuCI GTSAC 1 cut(s) 90
OliI CACNNNNGTG 1 cut(s) 173
PmaCI CACGTG 1 cut(s) 171
PmlI CACGTG 1 cut(s) 171
Ppu21I YACGTR 2 cut(s) 171, 285
PspCI CACGTG 1 cut(s) 171
RsaI GTAC 4 cut(s) 287, 308, 372, 394
RsaNI GTAC 4 cut(s) 286, 307, 371, 393
RseI CAYNNNNRTG 2 cut(s) 81, 173
SaqAI TTAA 1 cut(s) 225
Sau3AI GATC 1 cut(s) 118
SfaNI GCATC 2 cut(s) 23, 149
SfcI CTRYAG 1 cut(s) 28
SmiMI CAYNNNNRTG 2 cut(s) 81, 173
SnaBI TACGTA 1 cut(s) 285
Sse9I AATT 4 cut(s) 21, 222, 237, 374
TaaI ACNGT 2 cut(s) 10, 250
TaiI ACGT 2 cut(s) 173, 287
TaqI TCGA 2 cut(s) 115, 143
TasI AATT 4 cut(s) 21, 222, 237, 374
Tru1I TTAA 1 cut(s) 225
Tru9I TTAA 1 cut(s) 225
TseFI GTSAC 1 cut(s) 90
Tsp45I GTSAC 1 cut(s) 90
TspDTI ATGAA 2 cut(s) 17, 123
TspGWI ACGGA 1 cut(s) 32
XagI CCTNNNNNAGG 1 cut(s) 347
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.