Rh1CG122900
ERF Family

Belongs to the protein kinase superfamily. RIO-type Ser Thr kinase family

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr1C
Physical Location & Seq
Reverse (-)
26801063 .. 26803820
2758 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh1CG122900.1

Sequence Viewer

Length: 207 bp
ATGGTGAAGGTATGGGCTGAGAAAGAAAAGAGGAATCTGGACAGGATGGTGAAAAATGGAATTACATGCCCAACTGCAATTGATATAAAAGATCATGTTCTGGTCATGCTCGGTTGGGTTGAGTGCTCCTCTCATGATACAAACTATGGCATTCATGATTCAATAAAATGGTGTGCTTACGTGTGGCATGCTATAACTGGTTACTGA

Protein Analysis

68

Amino Acids

7.88

Weight (kDa)

6.88

Isoelectric Point (pI)

16.5

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
RIO1 PF01163 1 - 36 2.8e-09 RIO domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0018549)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AflIII ACRYGT 1 cut(s) 180
AgsI TTSAA 1 cut(s) 162
Alw21I GWGCWC 1 cut(s) 128
AsuHPI GGTGA 2 cut(s) 16, 61
Bbv12I GWGCWC 1 cut(s) 128
BccI CCATC 1 cut(s) 40
BplI GAGNNNNNCTC 2 cut(s) 113, 145
BsaAI YACGTR 1 cut(s) 181
Bse1I ACTGG 1 cut(s) 202
BseGI GGATG 1 cut(s) 51
BseMII CTCAG 1 cut(s) 9
BseNI ACTGG 1 cut(s) 202
BseRI GAGGAG 1 cut(s) 118
BsiHKAI GWGCWC 1 cut(s) 128
BsmI GAATGC 1 cut(s) 150
Bsp1286I GDGCHC 1 cut(s) 128
Bsp143I GATC 1 cut(s) 91
BspCNI CTCAG 1 cut(s) 10
BspHI TCATGA 2 cut(s) 133, 154
BsrI ACTGG 1 cut(s) 202
BssMI GATC 1 cut(s) 91
BstBAI YACGTR 1 cut(s) 181
BstC8I GCNNGC 1 cut(s) 189
BstDEI CTNAG 1 cut(s) 18
BstF5I GGATG 1 cut(s) 51
BstKTI GATC 1 cut(s) 94
BstMBI GATC 1 cut(s) 91
BstNSI RCATGY 2 cut(s) 69, 191
BtsCI GGATG 1 cut(s) 51
Cac8I GCNNGC 1 cut(s) 189
CciI TCATGA 2 cut(s) 133, 154
CviAII CATG 6 cut(s) 66, 95, 106, 134, 155, 188
CviJI RGCY 1 cut(s) 17
CviKI_1 RGCY 1 cut(s) 17
DdeI CTNAG 1 cut(s) 18
DpnI GATC 1 cut(s) 93
DpnII GATC 1 cut(s) 91
FaeI CATG 6 cut(s) 69, 98, 109, 137, 158, 191
FatI CATG 6 cut(s) 65, 94, 105, 133, 154, 187
FokI GGATG 1 cut(s) 58
Hin1II CATG 6 cut(s) 69, 98, 109, 137, 158, 191
HinfI GANTC 2 cut(s) 34, 158
HphI GGTGA 2 cut(s) 16, 61
Hpy188III TCNNGA 3 cut(s) 38, 134, 155
HpyCH4IV ACGT 1 cut(s) 180
HpyCH4V TGCA 1 cut(s) 77
HpyF3I CTNAG 1 cut(s) 18
HpySE526I ACGT 1 cut(s) 180
Hsp92II CATG 6 cut(s) 69, 98, 109, 137, 158, 191
Kzo9I GATC 1 cut(s) 91
LmnI GCTCC 1 cut(s) 131
LpnPI CCDG 4 cut(s) 23, 28, 86, 183
MaeII ACGT 1 cut(s) 180
MaeIII GTNAC 1 cut(s) 200
MalI GATC 1 cut(s) 93
MboI GATC 1 cut(s) 91
MfeI CAATTG 1 cut(s) 78
MhlI GDGCHC 1 cut(s) 128
MluCI AATT 2 cut(s) 60, 78
MnlI CCTC 2 cut(s) 24, 139
MunI CAATTG 1 cut(s) 78
Mva1269I GAATGC 1 cut(s) 150
NdeII GATC 1 cut(s) 91
NlaIII CATG 6 cut(s) 69, 98, 109, 137, 158, 191
NspI RCATGY 2 cut(s) 69, 191
PaeI GCATGC 1 cut(s) 191
PagI TCATGA 2 cut(s) 133, 154
PctI GAATGC 1 cut(s) 150
PfeI GAWTC 2 cut(s) 34, 158
Ppu21I YACGTR 1 cut(s) 181
Sau3AI GATC 1 cut(s) 91
SduI GDGCHC 1 cut(s) 128
SetI ASST 2 cut(s) 12, 183
SphI GCATGC 1 cut(s) 191
Sse9I AATT 2 cut(s) 60, 78
TaiI ACGT 1 cut(s) 183
TasI AATT 2 cut(s) 60, 78
TfiI GAWTC 2 cut(s) 34, 158
TspDTI ATGAA 1 cut(s) 143
XceI RCATGY 2 cut(s) 69, 191
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.