Rh5BG508100

udp-sugar pyrophosphorylase

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr5B
Physical Location & Seq
Reverse (-)
80629589 .. 80630670
1082 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh5BG508100.1

Sequence Viewer

Length: 216 bp
ATGGTGAAGGTATGGGCTGAGAAAGAAAAGAGGAATCTGGACAGGATGGTGATAAATCGAATTACATGCCCAACTGCAATTGATATAAAAGATCATGTTCTGTTAATTTTGGAACTTGGTCCGTACATTGAGGAGCTCACAAAAACAGGAGGTGCCATAAAGGAGTTTGTTAACCCAAAACACAAAGACACTAGTAAGACTTCATTCAAGCCCTAA

Protein Analysis

71

Amino Acids

8.15

Weight (kDa)

9.17

Isoelectric Point (pI)

22.2

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
RIO1 PF01163 1 - 36 1.7e-06 RIO domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0018549)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 152
AfaI GTAC 1 cut(s) 125
AgsI TTSAA 1 cut(s) 208
AhlI ACTAGT 1 cut(s) 191
AluBI AGCT 1 cut(s) 136
AluI AGCT 1 cut(s) 136
Alw21I GWGCWC 1 cut(s) 138
AspS9I GGNCC 1 cut(s) 119
AsuHPI GGTGA 2 cut(s) 16, 61
AvaII GGWCC 1 cut(s) 119
BanI GGYRCC 1 cut(s) 152
BanII GRGCYC 1 cut(s) 138
Bbv12I GWGCWC 1 cut(s) 138
BccI CCATC 1 cut(s) 40
BcgI CGANNNNNNTGC 2 cut(s) 48, 82
BcuI ACTAGT 1 cut(s) 191
BfaI CTAG 1 cut(s) 192
Bme18I GGWCC 1 cut(s) 119
BmgT120I GGNCC 1 cut(s) 119
BmiI GGNNCC 1 cut(s) 154
BseGI GGATG 1 cut(s) 51
BseMII CTCAG 1 cut(s) 9
BseRI GAGGAG 1 cut(s) 146
BshNI GGYRCC 1 cut(s) 152
BsiHKAI GWGCWC 1 cut(s) 138
Bsp1286I GDGCHC 1 cut(s) 138
Bsp143I GATC 1 cut(s) 91
BspCNI CTCAG 1 cut(s) 10
BspLI GGNNCC 1 cut(s) 154
BspT107I GGYRCC 1 cut(s) 152
BssMI GATC 1 cut(s) 91
BstDEI CTNAG 1 cut(s) 18
BstF5I GGATG 1 cut(s) 51
BstKTI GATC 1 cut(s) 94
BstMBI GATC 1 cut(s) 91
BstNSI RCATGY 1 cut(s) 69
BtsCI GGATG 1 cut(s) 51
Cfr13I GGNCC 1 cut(s) 119
Csp6I GTAC 1 cut(s) 124
CviAII CATG 2 cut(s) 66, 95
CviJI RGCY 3 cut(s) 17, 136, 211
CviKI_1 RGCY 3 cut(s) 17, 136, 211
CviQI GTAC 1 cut(s) 124
DdeI CTNAG 1 cut(s) 18
DpnI GATC 1 cut(s) 93
DpnII GATC 1 cut(s) 91
Ecl136II GAGCTC 1 cut(s) 136
Eco24I GRGCYC 1 cut(s) 138
Eco47I GGWCC 1 cut(s) 119
Eco53kI GAGCTC 1 cut(s) 136
EcoICRI GAGCTC 1 cut(s) 136
EcoT38I GRGCYC 1 cut(s) 138
FaeI CATG 2 cut(s) 69, 98
FaiI YATR 5 cut(s) 13, 67, 86, 96, 158
FatI CATG 2 cut(s) 65, 94
FokI GGATG 1 cut(s) 58
FriOI GRGCYC 1 cut(s) 138
FspBI CTAG 1 cut(s) 192
Hin1II CATG 2 cut(s) 69, 98
HincII GTYRAC 1 cut(s) 172
HindII GTYRAC 1 cut(s) 172
HinfI GANTC 1 cut(s) 34
HpaI GTTAAC 1 cut(s) 172
HphI GGTGA 2 cut(s) 16, 61
Hpy166II GTNNAC 1 cut(s) 172
Hpy188III TCNNGA 1 cut(s) 38
Hpy8I GTNNAC 1 cut(s) 172
HpyCH4V TGCA 1 cut(s) 77
HpyF3I CTNAG 1 cut(s) 18
Hsp92II CATG 2 cut(s) 69, 98
KspAI GTTAAC 1 cut(s) 172
Kzo9I GATC 1 cut(s) 91
LmnI GCTCC 1 cut(s) 133
LpnPI CCDG 3 cut(s) 23, 28, 132
MaeI CTAG 1 cut(s) 192
MalI GATC 1 cut(s) 93
MboI GATC 1 cut(s) 91
MfeI CAATTG 1 cut(s) 78
MhlI GDGCHC 1 cut(s) 138
MluCI AATT 3 cut(s) 60, 78, 105
MnlI CCTC 3 cut(s) 24, 124, 143
MseI TTAA 2 cut(s) 104, 171
MunI CAATTG 1 cut(s) 78
NdeII GATC 1 cut(s) 91
NlaIII CATG 2 cut(s) 69, 98
NlaIV GGNNCC 1 cut(s) 154
NspI RCATGY 1 cut(s) 69
PfeI GAWTC 1 cut(s) 34
Psp124BI GAGCTC 1 cut(s) 138
PspN4I GGNNCC 1 cut(s) 154
PspPI GGNCC 1 cut(s) 119
RsaI GTAC 1 cut(s) 125
RsaNI GTAC 1 cut(s) 124
SacI GAGCTC 1 cut(s) 138
SaqAI TTAA 2 cut(s) 104, 171
Sau3AI GATC 1 cut(s) 91
Sau96I GGNCC 1 cut(s) 119
SduI GDGCHC 1 cut(s) 138
SetI ASST 3 cut(s) 12, 138, 154
SgeI CNNG 7 cut(s) 50, 55, 78, 107, 128, 159, 204
SinI GGWCC 1 cut(s) 119
SpeI ACTAGT 1 cut(s) 191
Sse9I AATT 3 cut(s) 60, 78, 105
SspMI CTAG 1 cut(s) 192
SstI GAGCTC 1 cut(s) 138
TaqI TCGA 1 cut(s) 58
TasI AATT 3 cut(s) 60, 78, 105
TfiI GAWTC 1 cut(s) 34
Tru1I TTAA 2 cut(s) 104, 171
Tru9I TTAA 2 cut(s) 104, 171
TspDTI ATGAA 1 cut(s) 192
TspGWI ACGGA 1 cut(s) 111
VpaK11BI GGWCC 1 cut(s) 119
XceI RCATGY 1 cut(s) 69
XspI CTAG 1 cut(s) 192
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.