RLG00000016493
MYB Family

RNA polymerase II transcription regulator recruiting activity

Basic Information

Type: gene
Biological Identity
rosa_laevigata
Chr4
Physical Location & Seq
Forward (+)
7076943 .. 7077721
779 bp
Loading structure...
UTR
Exon/CDS
Intron
RLM00000016493

Sequence Viewer

Length: 525 bp
ATGGTGAGAAAACCGTGCTGTAACAAAAACAGTATTAACAAGGGGGCCTGGTCTGCTGAGGAAGATGATGCCCTTATTCGATACATTAGAACTCATGGACCATGCAAATGGGGAGACATTCGTCGTGGAGCTGGGTTAAACCGATGCGACAAGAGTTGCAGACTGCGATGGCAGAATTATCTGAGGCCTGGTATTAAGGGAGGAAACATTTCTGATGATGAAGAAGACCTCATTCTCAGACAACACAAGCTTCTTGGAAACAGGTATATAAGCGTTCCAGAACCGAAGAATTCTTCTGCTACTTTTCTAATGGATTTTGAAATGTACCTAAATGATCAGGACCTTTTCACATCTGACCTCCTAAATAGTACAAATATCGACCATGATTTGCACCTTGCAGAATGGATAAATCAATGTGAGGATGATGGTGATTTGCACCAAGAAGAATTGGGTAGAGCACATGGTTTTCTGTCACATGGAACTCATGAGCTTGAAGATTGGACGTTCATGGAAGAAGCTTTATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

175

Amino Acids

20.12

Weight (kDa)

5.1

Isoelectric Point (pI)

42.44

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Myb_DNA-binding PF00249 14 - 61 1.6e-16 Myb-like DNA-binding domain
Myb_DNA-bind_6 PF13921 17 - 76 1.2e-10 Myb-like DNA-binding domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0017476)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 523
AcsI RAATTY 1 cut(s) 289
AfaI GTAC 2 cut(s) 326, 370
AgsI TTSAA 2 cut(s) 320, 494
AjnI CCWGG 2 cut(s) 47, 187
AluBI AGCT 4 cut(s) 131, 250, 490, 518
AluI AGCT 4 cut(s) 131, 250, 490, 518
Alw21I GWGCWC 1 cut(s) 460
Alw26I GTCTC 1 cut(s) 108
AoxI GGCC 2 cut(s) 45, 185
ApoI RAATTY 1 cut(s) 289
Asp700I GAANNNNTTC 1 cut(s) 208
AspS9I GGNCC 3 cut(s) 45, 98, 340
AsuHPI GGTGA 2 cut(s) 16, 440
AvaII GGWCC 2 cut(s) 98, 340
BbsI GAAGAC 1 cut(s) 231
Bbv12I GWGCWC 1 cut(s) 460
BbvCI CCTCAGC 1 cut(s) 57
BccI CCATC 2 cut(s) 162, 419
BciT130I CCWGG 2 cut(s) 49, 189
BclI TGATCA 1 cut(s) 334
BcoDI GTCTC 1 cut(s) 108
Bme1390I CCNGG 2 cut(s) 49, 189
Bme18I GGWCC 2 cut(s) 98, 340
BmgT120I GGNCC 3 cut(s) 45, 98, 340
BmiI GGNNCC 1 cut(s) 46
BmrFI CCNGG 2 cut(s) 49, 189
BmsI GCATC 2 cut(s) 58, 134
BoxI GACNNNNGTC 1 cut(s) 120
BpiI GAAGAC 1 cut(s) 231
Bpu10I CCTNAGC 1 cut(s) 57
BseBI CCWGG 2 cut(s) 49, 189
BseGI GGATG 1 cut(s) 427
BseMII CTCAG 3 cut(s) 48, 173, 250
BseYI CCCAGC 1 cut(s) 131
BshFI GGCC 2 cut(s) 47, 187
BsiHKAI GWGCWC 1 cut(s) 460
BsmAI GTCTC 1 cut(s) 108
BsnI GGCC 2 cut(s) 47, 187
Bsp1286I GDGCHC 1 cut(s) 460
Bsp143I GATC 1 cut(s) 334
BspANI GGCC 2 cut(s) 47, 187
BspCNI CTCAG 3 cut(s) 49, 174, 249
BspHI TCATGA 1 cut(s) 484
BspLI GGNNCC 1 cut(s) 46
BssMI GATC 1 cut(s) 334
Bst2UI CCWGG 2 cut(s) 49, 189
Bst4CI ACNGT 2 cut(s) 15, 32
BstDEI CTNAG 3 cut(s) 57, 182, 236
BstF5I GGATG 1 cut(s) 427
BstKTI GATC 1 cut(s) 337
BstMAI GTCTC 1 cut(s) 108
BstMBI GATC 1 cut(s) 334
BstMWI GCNNNNNNNGC 1 cut(s) 53
BstNI CCWGG 2 cut(s) 49, 189
BstPAI GACNNNNGTC 1 cut(s) 120
BstSCI CCNGG 2 cut(s) 47, 187
BstV2I GAAGAC 1 cut(s) 231
BstXI CCANNNNNNTGG 1 cut(s) 108
BsuRI GGCC 2 cut(s) 47, 187
BtgZI GCGATG 1 cut(s) 181
BtsCI GGATG 1 cut(s) 427
CciI TCATGA 1 cut(s) 484
Cfr13I GGNCC 3 cut(s) 45, 98, 340
Csp6I GTAC 2 cut(s) 325, 369
CviAII CATG 7 cut(s) 95, 102, 383, 461, 476, 485, 508
CviJI RGCY 6 cut(s) 47, 131, 187, 250, 490, 518
CviKI_1 RGCY 6 cut(s) 47, 131, 187, 250, 490, 518
CviQI GTAC 2 cut(s) 325, 369
DdeI CTNAG 3 cut(s) 57, 182, 236
DpnI GATC 1 cut(s) 336
DpnII GATC 1 cut(s) 334
Eco147I AGGCCT 1 cut(s) 187
Eco47I GGWCC 2 cut(s) 98, 340
EcoO109I RGGNCCY 2 cut(s) 45, 340
EcoRI GAATTC 1 cut(s) 289
EcoRII CCWGG 2 cut(s) 47, 187
FaeI CATG 7 cut(s) 98, 105, 386, 464, 479, 488, 511
FatI CATG 7 cut(s) 94, 101, 382, 460, 475, 484, 507
FbaI TGATCA 1 cut(s) 334
FokI GGATG 1 cut(s) 434
GsaI CCCAGC 1 cut(s) 135
HaeIII GGCC 2 cut(s) 47, 187
Hin1II CATG 7 cut(s) 98, 105, 386, 464, 479, 488, 511
HindIII AAGCTT 2 cut(s) 248, 516
HphI GGTGA 2 cut(s) 16, 440
Hpy188I TCNGA 4 cut(s) 183, 214, 239, 355
Hpy188III TCNNGA 3 cut(s) 278, 338, 485
Hpy99I CGWCG 1 cut(s) 126
HpyCH4III ACNGT 2 cut(s) 15, 32
HpyCH4IV ACGT 1 cut(s) 503
HpyCH4V TGCA 5 cut(s) 105, 159, 391, 398, 436
HpyF10VI GCNNNNNNNGC 1 cut(s) 53
HpyF3I CTNAG 3 cut(s) 57, 182, 236
HpySE526I ACGT 1 cut(s) 503
Hsp92II CATG 7 cut(s) 98, 105, 386, 464, 479, 488, 511
Ksp22I TGATCA 1 cut(s) 334
Kzo9I GATC 1 cut(s) 334
LmnI GCTCC 1 cut(s) 128
LpnPI CCDG 8 cut(s) 34, 61, 117, 174, 201, 247, 291, 323
LweI GCATC 2 cut(s) 58, 134
MaeII ACGT 1 cut(s) 503
MaeIII GTNAC 2 cut(s) 20, 471
MalI GATC 1 cut(s) 336
MboI GATC 1 cut(s) 334
MboII GAAGA 8 cut(s) 74, 233, 236, 285, 298, 455, 506, 524
MhlI GDGCHC 1 cut(s) 460
MluCI AATT 3 cut(s) 175, 289, 446
MnlI CCTC 6 cut(s) 52, 177, 194, 239, 368, 412
MroXI GAANNNNTTC 1 cut(s) 208
MseI TTAA 3 cut(s) 36, 137, 195
MslI CAYNNNNRTG 1 cut(s) 106
MspR9I CCNGG 2 cut(s) 49, 189
MvaI CCWGG 2 cut(s) 49, 189
MwoI GCNNNNNNNGC 1 cut(s) 53
NdeII GATC 1 cut(s) 334
NlaIII CATG 7 cut(s) 98, 105, 386, 464, 479, 488, 511
NlaIV GGNNCC 1 cut(s) 46
NmuCI GTSAC 1 cut(s) 471
PagI TCATGA 1 cut(s) 484
PceI AGGCCT 1 cut(s) 187
PdmI GAANNNNTTC 1 cut(s) 208
PpuMI RGGWCCY 1 cut(s) 340
PshAI GACNNNNGTC 1 cut(s) 120
PsiI TTATAA 1 cut(s) 523
Psp5II RGGWCCY 1 cut(s) 340
Psp6I CCWGG 2 cut(s) 47, 187
PspFI CCCAGC 1 cut(s) 131
PspGI CCWGG 2 cut(s) 47, 187
PspN4I GGNNCC 1 cut(s) 46
PspPI GGNCC 3 cut(s) 45, 98, 340
PspPPI RGGWCCY 1 cut(s) 340
RsaI GTAC 2 cut(s) 326, 370
RsaNI GTAC 2 cut(s) 325, 369
RseI CAYNNNNRTG 1 cut(s) 106
SaqAI TTAA 3 cut(s) 36, 137, 195
Sau3AI GATC 1 cut(s) 334
Sau96I GGNCC 3 cut(s) 45, 98, 340
ScrFI CCNGG 2 cut(s) 49, 189
SduI GDGCHC 1 cut(s) 460
SfaNI GCATC 2 cut(s) 58, 134
SinI GGWCC 2 cut(s) 98, 340
SmiMI CAYNNNNRTG 1 cut(s) 106
Sse9I AATT 3 cut(s) 175, 289, 446
SseBI AGGCCT 1 cut(s) 187
StuI AGGCCT 1 cut(s) 187
StyD4I CCNGG 2 cut(s) 47, 187
TaaI ACNGT 2 cut(s) 15, 32
TaiI ACGT 1 cut(s) 506
TaqI TCGA 2 cut(s) 79, 378
TasI AATT 3 cut(s) 175, 289, 446
TatI WGTACW 1 cut(s) 368
Tru1I TTAA 3 cut(s) 36, 137, 195
Tru9I TTAA 3 cut(s) 36, 137, 195
TseFI GTSAC 1 cut(s) 471
Tsp45I GTSAC 1 cut(s) 471
TspDTI ATGAA 2 cut(s) 234, 496
VpaK11BI GGWCC 2 cut(s) 98, 340
XapI RAATTY 1 cut(s) 289
XmnI GAANNNNTTC 1 cut(s) 208
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.