Rmu_co7967050.1_g000001

G-type lectin S-receptor-like serine threonine-protein kinase

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co7967050.1
Physical Location & Seq
Reverse (-)
2 .. 446
445 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co7967050.1_g000001.1.cds

Sequence Viewer

Length: 445 bp
atgttgctgggatttgatagtaatactggaaaatggaatttgttgacatcatggaaaggtgaaaatgatccatcaactgggatattctcggttggattgtcagcacagatgccaacacaagtgttcatttggaaaaatggatcaactccccagtggagaagtggtccatgggataaatcaaagttcattggtgtacctaatatggattctcaatatctaagtggatttactctagatgataatgtgaaacagggaacaaggtacttctcctacagtttatttgacaaaactcttgcatatatggacatatcttctgatggtgtcttaacggttatgctttcggaaaatggcgagaaatggagtattaactatgctgcaccgactaatacatgtgaaagttatggagcatgtggaccttttgggttttgcaaagcttctgacccta

Protein Analysis

148

Amino Acids

16.35

Weight (kDa)

4.76

Isoelectric Point (pI)

27.87

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0018511)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 77
AclWI GGATC 2 cut(s) 62, 148
AcsI RAATTY 1 cut(s) 37
AfaI GTAC 2 cut(s) 195, 263
AfiI CCNNNNNNNGG 1 cut(s) 77
AflIII ACRYGT 1 cut(s) 389
AluBI AGCT 1 cut(s) 434
AluI AGCT 1 cut(s) 434
AlwI GGATC 2 cut(s) 62, 148
ApeKI GCWGC 1 cut(s) 374
ApoI RAATTY 1 cut(s) 37
AspS9I GGNCC 2 cut(s) 164, 413
AsuHPI GGTGA 1 cut(s) 71
AvaII GGWCC 2 cut(s) 164, 413
BbvI GCAGC 1 cut(s) 361
BccI CCATC 2 cut(s) 79, 311
BfaI CTAG 1 cut(s) 233
BfmI CTRYAG 1 cut(s) 271
BisI GCNGC 1 cut(s) 375
BlsI GCNGC 1 cut(s) 376
Bme18I GGWCC 2 cut(s) 164, 413
BmgT120I GGNCC 2 cut(s) 164, 413
BmrI ACTGGG 2 cut(s) 87, 145
BmsI GCATC 1 cut(s) 99
BmuI ACTGGG 2 cut(s) 87, 145
BsaJI CCNNGG 1 cut(s) 167
BsaXI ACNNNNNCTCC 2 cut(s) 148, 178
Bsc4I CCNNNNNNNGG 1 cut(s) 77
Bse1I ACTGG 3 cut(s) 31, 82, 151
BseDI CCNNGG 1 cut(s) 167
BseLI CCNNNNNNNGG 1 cut(s) 77
BseNI ACTGG 3 cut(s) 31, 82, 151
BseXI GCAGC 1 cut(s) 361
BseYI CCCAGC 1 cut(s) 7
BsgI GTGCAG 1 cut(s) 360
BslI CCNNNNNNNGG 1 cut(s) 77
Bsp143I GATC 2 cut(s) 67, 140
Bsp19I CCATGG 1 cut(s) 167
BspPI GGATC 2 cut(s) 62, 148
BsrI ACTGG 3 cut(s) 31, 82, 151
BssECI CCNNGG 1 cut(s) 167
BssMI GATC 2 cut(s) 67, 140
BssT1I CCWWGG 1 cut(s) 167
Bst4CI ACNGT 2 cut(s) 275, 331
BstDEI CTNAG 1 cut(s) 218
BstDSI CCRYGG 1 cut(s) 167
BstKTI GATC 2 cut(s) 70, 143
BstMBI GATC 2 cut(s) 67, 140
BstNSI RCATGY 2 cut(s) 393, 411
BstSFI CTRYAG 1 cut(s) 271
BstV1I GCAGC 1 cut(s) 361
BtgI CCRYGG 1 cut(s) 167
BtsIMutI CAGTG 1 cut(s) 158
Cfr13I GGNCC 2 cut(s) 164, 413
Csp6I GTAC 2 cut(s) 194, 262
CviAII CATG 4 cut(s) 51, 168, 390, 408
CviJI RGCY 1 cut(s) 434
CviKI_1 RGCY 1 cut(s) 434
CviQI GTAC 2 cut(s) 194, 262
DdeI CTNAG 1 cut(s) 218
DpnI GATC 2 cut(s) 69, 142
DpnII GATC 2 cut(s) 67, 140
Eco130I CCWWGG 1 cut(s) 167
Eco47I GGWCC 2 cut(s) 164, 413
EcoT14I CCWWGG 1 cut(s) 167
ErhI CCWWGG 1 cut(s) 167
FaeI CATG 4 cut(s) 54, 171, 393, 411
FatI CATG 4 cut(s) 50, 167, 389, 407
Fnu4HI GCNGC 1 cut(s) 375
Fsp4HI GCNGC 1 cut(s) 375
FspBI CTAG 1 cut(s) 233
GluI GCNGC 1 cut(s) 375
GsaI CCCAGC 1 cut(s) 11
Hin1II CATG 4 cut(s) 54, 171, 393, 411
HincII GTYRAC 1 cut(s) 45
HindII GTYRAC 1 cut(s) 45
HindIII AAGCTT 1 cut(s) 432
HinfI GANTC 1 cut(s) 206
HphI GGTGA 1 cut(s) 71
Hpy166II GTNNAC 3 cut(s) 45, 194, 413
Hpy188I TCNGA 3 cut(s) 316, 343, 439
Hpy188III TCNNGA 1 cut(s) 233
Hpy8I GTNNAC 3 cut(s) 45, 194, 413
HpyCH4III ACNGT 2 cut(s) 275, 331
HpyCH4V TGCA 3 cut(s) 296, 377, 429
HpyF3I CTNAG 1 cut(s) 218
Hsp92II CATG 4 cut(s) 54, 171, 393, 411
Kzo9I GATC 2 cut(s) 67, 140
LmnI GCTCC 1 cut(s) 404
LpnPI CCDG 4 cut(s) 12, 63, 164, 236
Lsp1109I GCAGC 1 cut(s) 361
LweI GCATC 1 cut(s) 99
MaeI CTAG 1 cut(s) 233
MalI GATC 2 cut(s) 69, 142
MboI GATC 2 cut(s) 67, 140
MboII GAAGA 1 cut(s) 303
MluCI AATT 1 cut(s) 37
MmeI TCCRAC 1 cut(s) 73
MseI TTAA 2 cut(s) 326, 366
NcoI CCATGG 1 cut(s) 167
NdeII GATC 2 cut(s) 67, 140
NlaIII CATG 4 cut(s) 54, 171, 393, 411
NspI RCATGY 2 cut(s) 393, 411
PciI ACATGT 1 cut(s) 389
PfeI GAWTC 1 cut(s) 206
PflMI CCANNNNNTGG 1 cut(s) 77
PkrI GCNGC 1 cut(s) 376
PscI ACATGT 1 cut(s) 389
PspFI CCCAGC 1 cut(s) 7
PspPI GGNCC 2 cut(s) 164, 413
RsaI GTAC 2 cut(s) 195, 263
RsaNI GTAC 2 cut(s) 194, 262
SaqAI TTAA 2 cut(s) 326, 366
SatI GCNGC 1 cut(s) 375
Sau3AI GATC 2 cut(s) 67, 140
Sau96I GGNCC 2 cut(s) 164, 413
SetI ASST 5 cut(s) 61, 199, 263, 418, 436
SfaNI GCATC 1 cut(s) 99
SfcI CTRYAG 1 cut(s) 271
SinI GGWCC 2 cut(s) 164, 413
Sse9I AATT 1 cut(s) 37
SspMI CTAG 1 cut(s) 233
StyI CCWWGG 1 cut(s) 167
TaaI ACNGT 2 cut(s) 275, 331
TasI AATT 1 cut(s) 37
TfiI GAWTC 1 cut(s) 206
Tru1I TTAA 2 cut(s) 326, 366
Tru9I TTAA 2 cut(s) 326, 366
TscAI CASTG 1 cut(s) 158
TseI GCWGC 1 cut(s) 374
TspDTI ATGAA 2 cut(s) 115, 175
TspRI CASTG 1 cut(s) 158
Van91I CCANNNNNTGG 1 cut(s) 77
VpaK11BI GGWCC 2 cut(s) 164, 413
XapI RAATTY 1 cut(s) 37
XbaI TCTAGA 1 cut(s) 232
XceI RCATGY 2 cut(s) 393, 411
XcmI CCANNNNNNNNNTGG 1 cut(s) 158
XspI CTAG 1 cut(s) 233
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.