Rmu_co7971634.1_g000001

ATP-dependent Clp protease ATP-binding subunit

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co7971634.1
Physical Location & Seq
Reverse (-)
1 .. 418
418 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co7971634.1_g000001.1.cds

Sequence Viewer

Length: 246 bp
atggcaaagaaagcgatggctaagaataccggtgccaggggattaagatcgatattggaaagtattctaaccgaagccatgtatgagattccggatgttaaaacaggagaagatagagtagatgctgtagtggttgatgaggagtctgtggattcaggaaatgcccctggatgtggagggaagattgttcgaggggacggtgcattggaaagataccttcgtgaaataaagttgaaagaatcagtg

Protein Analysis

82

Amino Acids

8.81

Weight (kDa)

5.14

Isoelectric Point (pI)

31.85

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0018545)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 32
AccIII TCCGGA 1 cut(s) 91
AfiI CCNNNNNNNGG 2 cut(s) 36, 173
AgeI ACCGGT 1 cut(s) 29
AgsI TTSAA 1 cut(s) 235
AjnI CCWGG 2 cut(s) 35, 166
Aor13HI TCCGGA 1 cut(s) 91
AsiGI ACCGGT 1 cut(s) 29
Asp700I GAANNNNTTC 1 cut(s) 63
BaeI ACNNNNGTAYC 2 cut(s) 205, 238
BanI GGYRCC 1 cut(s) 32
BccI CCATC 1 cut(s) 10
BciT130I CCWGG 2 cut(s) 37, 168
BfmI CTRYAG 1 cut(s) 126
Bme1390I CCNGG 2 cut(s) 37, 168
BmiI GGNNCC 1 cut(s) 34
BmrFI CCNGG 2 cut(s) 37, 168
BmsI GCATC 1 cut(s) 112
Bsa29I ATCGAT 1 cut(s) 50
BsaBI GATNNNNATC 1 cut(s) 46
BsaJI CCNNGG 2 cut(s) 36, 166
BsaWI WCCGGW 2 cut(s) 29, 91
Bsc4I CCNNNNNNNGG 2 cut(s) 36, 173
Bse118I RCCGGY 1 cut(s) 29
Bse8I GATNNNNATC 1 cut(s) 46
BseAI TCCGGA 1 cut(s) 91
BseBI CCWGG 2 cut(s) 37, 168
BseCI ATCGAT 1 cut(s) 50
BseDI CCNNGG 2 cut(s) 36, 166
BseGI GGATG 2 cut(s) 100, 176
BseJI GATNNNNATC 1 cut(s) 46
BseLI CCNNNNNNNGG 2 cut(s) 36, 173
BseRI GAGGAG 1 cut(s) 155
BshNI GGYRCC 1 cut(s) 32
BshTI ACCGGT 1 cut(s) 29
BshVI ATCGAT 1 cut(s) 50
BsiSI CCGG 2 cut(s) 30, 92
BslFI GGGAC 1 cut(s) 209
BslI CCNNNNNNNGG 2 cut(s) 36, 173
BsmFI GGGAC 1 cut(s) 209
Bsp13I TCCGGA 1 cut(s) 91
Bsp143I GATC 1 cut(s) 47
BspDI ATCGAT 1 cut(s) 50
BspEI TCCGGA 1 cut(s) 91
BspLI GGNNCC 1 cut(s) 34
BspT107I GGYRCC 1 cut(s) 32
BsrFI RCCGGY 1 cut(s) 29
BssAI RCCGGY 1 cut(s) 29
BssECI CCNNGG 2 cut(s) 36, 166
BssMI GATC 1 cut(s) 47
Bst2UI CCWGG 2 cut(s) 37, 168
Bst4CI ACNGT 1 cut(s) 200
BstDEI CTNAG 1 cut(s) 21
BstF5I GGATG 2 cut(s) 100, 176
BstKTI GATC 1 cut(s) 50
BstMBI GATC 1 cut(s) 47
BstMWI GCNNNNNNNGC 1 cut(s) 11
BstNI CCWGG 2 cut(s) 37, 168
BstSCI CCNGG 2 cut(s) 35, 166
BstSFI CTRYAG 1 cut(s) 126
Bsu15I ATCGAT 1 cut(s) 50
BsuTUI ATCGAT 1 cut(s) 50
BtgZI GCGATG 1 cut(s) 29
BtsCI GGATG 2 cut(s) 100, 176
Cfr10I RCCGGY 1 cut(s) 29
ClaI ATCGAT 1 cut(s) 50
CspAI ACCGGT 1 cut(s) 29
CviAII CATG 1 cut(s) 79
CviJI RGCY 2 cut(s) 20, 77
CviKI_1 RGCY 2 cut(s) 20, 77
DdeI CTNAG 1 cut(s) 21
DpnI GATC 1 cut(s) 49
DpnII GATC 1 cut(s) 47
EcoRII CCWGG 2 cut(s) 35, 166
FaeI CATG 1 cut(s) 82
FaiI YATR 2 cut(s) 80, 84
FaqI GGGAC 1 cut(s) 209
FatI CATG 1 cut(s) 78
FokI GGATG 2 cut(s) 107, 183
HapII CCGG 2 cut(s) 30, 92
Hin1II CATG 1 cut(s) 82
HinfI GANTC 4 cut(s) 88, 143, 152, 239
HpaII CCGG 2 cut(s) 30, 92
Hpy188III TCNNGA 3 cut(s) 92, 156, 221
HpyAV CCTTC 1 cut(s) 227
HpyCH4III ACNGT 1 cut(s) 200
HpyCH4V TGCA 1 cut(s) 203
HpyF10VI GCNNNNNNNGC 1 cut(s) 11
HpyF3I CTNAG 1 cut(s) 21
Hsp92II CATG 1 cut(s) 82
Kpn2I TCCGGA 1 cut(s) 91
Kzo9I GATC 1 cut(s) 47
LpnPI CCDG 8 cut(s) 22, 43, 49, 90, 105, 141, 153, 180
LweI GCATC 1 cut(s) 112
MalI GATC 1 cut(s) 49
MboI GATC 1 cut(s) 47
MboII GAAGA 2 cut(s) 122, 193
MlyI GAGTC 1 cut(s) 152
MnlI CCTC 3 cut(s) 133, 170, 185
MroI TCCGGA 1 cut(s) 91
MroXI GAANNNNTTC 1 cut(s) 63
MseI TTAA 2 cut(s) 44, 99
MspI CCGG 2 cut(s) 30, 92
MspR9I CCNGG 2 cut(s) 37, 168
MvaI CCWGG 2 cut(s) 37, 168
MwoI GCNNNNNNNGC 1 cut(s) 11
NdeII GATC 1 cut(s) 47
NlaIII CATG 1 cut(s) 82
NlaIV GGNNCC 1 cut(s) 34
PdmI GAANNNNTTC 1 cut(s) 63
PfeI GAWTC 3 cut(s) 88, 152, 239
PinAI ACCGGT 1 cut(s) 29
PleI GAGTC 1 cut(s) 151
PpsI GAGTC 1 cut(s) 151
Psp6I CCWGG 2 cut(s) 35, 166
PspGI CCWGG 2 cut(s) 35, 166
PspN4I GGNNCC 1 cut(s) 34
SaqAI TTAA 2 cut(s) 44, 99
Sau3AI GATC 1 cut(s) 47
SchI GAGTC 1 cut(s) 152
ScrFI CCNGG 2 cut(s) 37, 168
SetI ASST 1 cut(s) 219
SfaNI GCATC 1 cut(s) 112
SfcI CTRYAG 1 cut(s) 126
StyD4I CCNGG 2 cut(s) 35, 166
TaaI ACNGT 1 cut(s) 200
TaqI TCGA 2 cut(s) 50, 190
TfiI GAWTC 3 cut(s) 88, 152, 239
Tru1I TTAA 2 cut(s) 44, 99
Tru9I TTAA 2 cut(s) 44, 99
XmnI GAANNNNTTC 1 cut(s) 63
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.