Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_co7976164.1

Orthogroup ID

OG0013221

Physical Location & Seq

Genomic Coordinates Forward (+)

1 .. 498

Gene Structure 498 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_co7976164.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 203 bp

atgagcgtgttccaagtgagctgaagaaagctattatgcaagctcgtatggataagaagcttactcaggctcagcttgcacaaattatcaatgagaagcctcaagtgatccaagagtatgaatctgggaaagctattccaaaccaacaggtaattggcaagttagagagagctctgggagctaaactgcgtggaaagaaataa

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0003674 GO:0003676 GO:0003712 GO:0003713 GO:0003723 GO:0003729 GO:0005488 GO:0005575 GO:0005622 GO:0005623 GO:0005634 GO:0005730 GO:0006355 GO:0008150 GO:0009889 GO:0009891 GO:0009893 GO:0010468 GO:0010556 GO:0010557 GO:0010604 GO:0010628 GO:0019219 GO:0019222 GO:0031323 GO:0031325 GO:0031326 GO:0031328 GO:0031974 GO:0031981 GO:0043226 GO:0043227 GO:0043228 GO:0043229 GO:0043231 GO:0043232 GO:0043233 GO:0044422 GO:0044424 GO:0044428 GO:0044446 GO:0044464 GO:0045893 GO:0045935 GO:0048518 GO:0048522 GO:0050789 GO:0050794 GO:0051171 GO:0051173 GO:0051252 GO:0051254 GO:0060255 GO:0065007 GO:0070013 GO:0080090 GO:0097159 GO:0140110 GO:1901363 GO:1902680 GO:1903506 GO:1903508 GO:2000112 GO:2001141

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

HTH_3 MBF1

Protein Analysis

66

Amino Acids

7.44

Weight (kDa)

10.07

Isoelectric Point (pI)

11.9

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0013221)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT2G42680 AT3G58680
fragaria_vesca	FvH4_6g27570
malus_domestica	MD17G1265800.v1.1 MD17G1265900.v1.1
prunus_persica	Prupe.3G116500_v2.0.a1 Prupe.3G116500_v2.0.a1
pyrus_communis	pycom17g26550 pycom17g26560
rosa_chinensis	RchiOBHm_Chr2g0130001
rosa_laevigata	RLG00000019118
rosa_multiflora	Rmu_co7976164.1_g000001 Rmu_sc0005625.1_g000013 Rmu_sc0009900.1_g000008
rosa_roxburghii	Rroxscaffold_2G00114150
rosa_rugosa	Rorug02G0290900
rosa_samantha	Rh2AG342300
rosa_wichuraiana	Rw2G027710

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AclWI	GGATC	1 cut(s)	102
AcuI	CTGAAG	1 cut(s)	43
AluBI	AGCT	8 cut(s)	21, 31, 43, 60, 75, 133, 172, 181
AluI	AGCT	8 cut(s)	21, 31, 43, 60, 75, 133, 172, 181
Alw21I	GWGCWC	1 cut(s)	174
AlwI	GGATC	1 cut(s)	102
BanII	GRGCYC	1 cut(s)	174
Bbv12I	GWGCWC	1 cut(s)	174
BlpI	GCTNAGC	1 cut(s)	71
Bpu1102I	GCTNAGC	1 cut(s)	71
BpuEI	CTTGAG	1 cut(s)	86
BseMII	CTCAG	2 cut(s)	79, 85
BsiHKAI	GWGCWC	1 cut(s)	174
Bsp1286I	GDGCHC	1 cut(s)	174
Bsp143I	GATC	1 cut(s)	107
Bsp1720I	GCTNAGC	1 cut(s)	71
BspCNI	CTCAG	2 cut(s)	78, 84
BspPI	GGATC	1 cut(s)	102
BssMI	GATC	1 cut(s)	107
BstC8I	GCNNGC	2 cut(s)	41, 77
BstDEI	CTNAG	2 cut(s)	65, 71
BstKTI	GATC	1 cut(s)	110
BstMBI	GATC	1 cut(s)	107
BstMWI	GCNNNNNNNGC	2 cut(s)	76, 178
Cac8I	GCNNGC	2 cut(s)	41, 77
DdeI	CTNAG	2 cut(s)	65, 71
DpnI	GATC	1 cut(s)	109
DpnII	GATC	1 cut(s)	107
Ecl136II	GAGCTC	1 cut(s)	172
Eco24I	GRGCYC	1 cut(s)	174
Eco53kI	GAGCTC	1 cut(s)	172
Eco57I	CTGAAG	1 cut(s)	43
EcoICRI	GAGCTC	1 cut(s)	172
EcoT38I	GRGCYC	1 cut(s)	174
FaiI	YATR	3 cut(s)	37, 49, 119
FriOI	GRGCYC	1 cut(s)	174
HindIII	AAGCTT	1 cut(s)	58
HinfI	GANTC	1 cut(s)	121
HpyCH4V	TGCA	2 cut(s)	39, 79
HpyF10VI	GCNNNNNNNGC	2 cut(s)	76, 178
HpyF3I	CTNAG	2 cut(s)	65, 71
Kzo9I	GATC	1 cut(s)	107
LmnI	GCTCC	1 cut(s)	178
LpnPI	CCDG	4 cut(s)	52, 110, 133, 160
MalI	GATC	1 cut(s)	109
MboI	GATC	1 cut(s)	107
MboII	GAAGA	1 cut(s)	36
MhlI	GDGCHC	1 cut(s)	174
MluCI	AATT	2 cut(s)	83, 152
MnlI	CCTC	1 cut(s)	110
MwoI	GCNNNNNNNGC	2 cut(s)	76, 178
NdeII	GATC	1 cut(s)	107
PfeI	GAWTC	1 cut(s)	121
Psp124BI	GAGCTC	1 cut(s)	174
SacI	GAGCTC	1 cut(s)	174
Sau3AI	GATC	1 cut(s)	107
SduI	GDGCHC	1 cut(s)	174
SetI	ASST	9 cut(s)	23, 33, 45, 62, 77, 135, 152, 174, 183
SmlI	CTYRAG	1 cut(s)	101
SmoI	CTYRAG	1 cut(s)	101
Sse9I	AATT	2 cut(s)	83, 152
SstI	GAGCTC	1 cut(s)	174
TasI	AATT	2 cut(s)	83, 152
TfiI	GAWTC	1 cut(s)	121
TspDTI	ATGAA	1 cut(s)	134
XcmI	CCANNNNNNNNNTGG	1 cut(s)	151

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.