Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_co7987260.1

Orthogroup ID

OG0005033

Physical Location & Seq

Genomic Coordinates Forward (+)

1 .. 472

Gene Structure 472 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_co7987260.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 387 bp

agagataagaatggtgatgatgaactaaagcattatgaagatggcaatgaggaatcaggttctctgaggaactattcaaccaagaaaagtaatgatcagatggtcacttcaagtaaagaggacttttcctcaaagggatcgctgggaaatatggaaacacaggacagtcgaggtatcggtgatcttgacagtgaaggattgagcagacaggatgatctttggaaagctggtccagaatatcaaagtgattatgaaaagtcgcctaatggggatgatgtttccagagcaggctctgggaaggattacaacatgctgaaggctcagaatagaagctctctggcatctaaggcggatatgttttctgatgacgctagtgcagaagagtaa

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

Filamin RRM_1

Protein Analysis

128

Amino Acids

14.09

Weight (kDa)

4.47

Isoelectric Point (pI)

44.99

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0005033)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT3G23900 AT3G23900 AT3G23900 AT3G23900
fragaria_vesca	FvH4_4g13380 FvH4_4g13380
malus_domestica	MD04G1016500.v1.1
prunus_persica	Prupe.1G163200_v2.0.a1 Prupe.1G163200_v2.0.a1 Prupe.1G163200_v2.0.a1 Prupe.1G163200_v2.0.a1
pyrus_communis	pycom04g01250 pycom04g01260
rosa_chinensis	RchiOBHm_Chr4g0413751
rosa_laevigata	RLG00000008196
rosa_multiflora	Rmu_co7987260.1_g000001 Rmu_co8411523.1_g000001 Rmu_sc0004133.1_g000004 Rmu_sc0008092.1_g000014
rosa_roxburghii	Rroxscaffold_5G00357670
rosa_rugosa	Rorug04G0122900 Rorug04G0123000 Rorug04G0123100 Rorug04G0123100 Rorug04G0123100
rosa_samantha	Rh4AG182400 Rh4BG181500 Rh4CG193600 Rh4DG178000
rosa_wichuraiana	Rw4G015260

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AciI	CCGC	1 cut(s)	350
AclWI	GGATC	1 cut(s)	145
AcuI	CTGAAG	1 cut(s)	335
AgsI	TTSAA	2 cut(s)	78, 111
AluBI	AGCT	2 cut(s)	227, 333
AluI	AGCT	2 cut(s)	227, 333
AlwI	GGATC	1 cut(s)	145
AlwNI	CAGNNNCTG	1 cut(s)	293
AspS9I	GGNCC	1 cut(s)	230
AsuHPI	GGTGA	2 cut(s)	26, 191
AvaII	GGWCC	1 cut(s)	230
BccI	CCATC	2 cut(s)	35, 94
BclI	TGATCA	1 cut(s)	94
BfaI	CTAG	1 cut(s)	372
Bme18I	GGWCC	1 cut(s)	230
BmgT120I	GGNCC	1 cut(s)	230
BmsI	GCATC	1 cut(s)	350
Bse3DI	GCAATG	1 cut(s)	52
BseGI	GGATG	2 cut(s)	217, 277
BseMI	GCAATG	1 cut(s)	52
BseMII	CTCAG	2 cut(s)	56, 335
BseYI	CCCAGC	1 cut(s)	142
Bsp143I	GATC	4 cut(s)	94, 137, 181, 214
BspACI	CCGC	1 cut(s)	350
BspCNI	CTCAG	2 cut(s)	57, 334
BspPI	GGATC	1 cut(s)	145
BsrDI	GCAATG	1 cut(s)	52
BssMI	GATC	4 cut(s)	94, 137, 181, 214
Bst4CI	ACNGT	2 cut(s)	167, 191
Bst6I	CTCTTC	1 cut(s)	375
BstC8I	GCNNGC	1 cut(s)	289
BstDEI	CTNAG	3 cut(s)	65, 321, 345
BstF5I	GGATG	2 cut(s)	217, 277
BstKTI	GATC	4 cut(s)	97, 140, 184, 217
BstMBI	GATC	4 cut(s)	94, 137, 181, 214
BstMWI	GCNNNNNNNGC	1 cut(s)	347
BstNSI	RCATGY	1 cut(s)	313
BtsCI	GGATG	2 cut(s)	217, 277
BtsIMutI	CAGTG	1 cut(s)	196
Cac8I	GCNNGC	1 cut(s)	289
CaiI	CAGNNNCTG	1 cut(s)	293
Cfr13I	GGNCC	1 cut(s)	230
CseI	GACGC	1 cut(s)	377
CviAII	CATG	1 cut(s)	310
CviJI	RGCY	4 cut(s)	227, 291, 320, 333
CviKI_1	RGCY	4 cut(s)	227, 291, 320, 333
DdeI	CTNAG	3 cut(s)	65, 321, 345
DpnI	GATC	4 cut(s)	96, 139, 183, 216
DpnII	GATC	4 cut(s)	94, 137, 181, 214
Eam1104I	CTCTTC	1 cut(s)	375
EarI	CTCTTC	1 cut(s)	375
EciI	GGCGGA	1 cut(s)	365
Eco47I	GGWCC	1 cut(s)	230
Eco57I	CTGAAG	1 cut(s)	335
FaeI	CATG	1 cut(s)	313
FaiI	YATR	5 cut(s)	36, 152, 252, 311, 356
FatI	CATG	1 cut(s)	309
FbaI	TGATCA	1 cut(s)	94
FokI	GGATG	2 cut(s)	224, 284
FspBI	CTAG	1 cut(s)	372
GsaI	CCCAGC	1 cut(s)	146
HgaI	GACGC	1 cut(s)	377
Hin1II	CATG	1 cut(s)	313
HinfI	GANTC	1 cut(s)	53
HphI	GGTGA	2 cut(s)	26, 191
Hpy188I	TCNGA	4 cut(s)	66, 99, 324, 364
Hpy188III	TCNNGA	3 cut(s)	185, 233, 282
HpyAV	CCTTC	3 cut(s)	188, 292, 310
HpyCH4III	ACNGT	2 cut(s)	167, 191
HpyCH4V	TGCA	1 cut(s)	377
HpyF10VI	GCNNNNNNNGC	1 cut(s)	347
HpyF3I	CTNAG	3 cut(s)	65, 321, 345
Hsp92II	CATG	1 cut(s)	313
Ksp22I	TGATCA	1 cut(s)	94
Kzo9I	GATC	4 cut(s)	94, 137, 181, 214
LweI	GCATC	1 cut(s)	350
MaeI	CTAG	1 cut(s)	372
MaeIII	GTNAC	1 cut(s)	103
MalI	GATC	4 cut(s)	96, 139, 183, 216
MboI	GATC	4 cut(s)	94, 137, 181, 214
MboII	GAAGA	1 cut(s)	50
MnlI	CCTC	5 cut(s)	43, 60, 112, 139, 164
MwoI	GCNNNNNNNGC	1 cut(s)	347
NdeII	GATC	4 cut(s)	94, 137, 181, 214
NlaIII	CATG	1 cut(s)	313
NmuCI	GTSAC	1 cut(s)	103
NspI	RCATGY	1 cut(s)	313
PfeI	GAWTC	1 cut(s)	53
PspFI	CCCAGC	1 cut(s)	142
PspPI	GGNCC	1 cut(s)	230
PstNI	CAGNNNCTG	1 cut(s)	293
Sau3AI	GATC	4 cut(s)	94, 137, 181, 214
Sau96I	GGNCC	1 cut(s)	230
SetI	ASST	4 cut(s)	61, 175, 229, 335
SfaNI	GCATC	1 cut(s)	350
SinI	GGWCC	1 cut(s)	230
SsiI	CCGC	1 cut(s)	350
SspMI	CTAG	1 cut(s)	372
TaaI	ACNGT	2 cut(s)	167, 191
TaqI	TCGA	1 cut(s)	169
TfiI	GAWTC	1 cut(s)	53
TscAI	CASTG	1 cut(s)	196
TseFI	GTSAC	1 cut(s)	103
Tsp45I	GTSAC	1 cut(s)	103
TspDTI	ATGAA	3 cut(s)	36, 51, 267
TspRI	CASTG	1 cut(s)	196
VpaK11BI	GGWCC	1 cut(s)	230
XceI	RCATGY	1 cut(s)	313
XspI	CTAG	1 cut(s)	372

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.