Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_co8011570.1

Orthogroup ID

OG0018897

Physical Location & Seq

Genomic Coordinates Reverse (-)

1 .. 533

Gene Structure 533 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_co8011570.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 284 bp

ggaggccttcttctgtaagtagaggaatcggtaaatatagcactgctgctgccgctgctgctgaggacccaatcattccacctgttaaagtagattacactaagcttctgattaatggacagtttgtagatgcagcgtcagaaaaaacatttcccacattggaccctcggactggggacgtgattgctcatgttgctgaaggtgatgctgaagatgtaaatcgggcagttgctgctgctagaaaagcatttgacgaaggaccatggccaaagatgacagcatat

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0000166 GO:0003674 GO:0003824 GO:0004029 GO:0005488 GO:0005524 GO:0005575 GO:0005622 GO:0005623 GO:0005737 GO:0005739 GO:0008144 GO:0008150 GO:0008152 GO:0009507 GO:0009536 GO:0010035 GO:0010038 GO:0016491 GO:0016620 GO:0016903 GO:0017076 GO:0030554 GO:0032553 GO:0032555 GO:0032559 GO:0035639 GO:0036094 GO:0042221 GO:0043167 GO:0043168 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0044424 GO:0044444 GO:0044464 GO:0046686 GO:0050896 GO:0055114 GO:0097159 GO:0097367 GO:1901265 GO:1901363

KEGG Pathways

Metabolic & Signaling

ko00010 ko00053 ko00071 ko00280 ko00310 ko00330 ko00340 ko00380 ko00410 ko00561 ko00620 ko00625 ko00903 ko00981 ko01100 ko01110 ko01120 ko01130 map00010 map00053 map00071 map00280 map00310 map00330 map00340 map00380 map00410 map00561 map00620 map00625 map00903 map00981 map01100 map01110 map01120 map01130

Pfam Domains

Protein Families

Aldedh

Protein Analysis

94

Amino Acids

9.94

Weight (kDa)

5.26

Isoelectric Point (pI)

21.62

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0018897)

Species	Orthologous Gene IDs
malus_domestica	MD02G1049000.v1.1
pyrus_communis	pycom02g04110 pycom02g04140
rosa_chinensis	RchiOBHm_Chr3g0491961
rosa_multiflora	Rmu_co8011570.1_g000001 Rmu_sc0004195.1_g000001
rosa_samantha	Rh2AG056100 Rh2BG054700 Rh2CG057000

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AciI	CCGC	1 cut(s)	53
AcoI	YGGCCR	1 cut(s)	265
AcuI	CTGAAG	2 cut(s)	218, 230
AfiI	CCNNNNNNNGG	1 cut(s)	172
AjiI	CACGTC	1 cut(s)	180
AluBI	AGCT	1 cut(s)	105
AluI	AGCT	1 cut(s)	105
AlwNI	CAGNNNCTG	1 cut(s)	232
AoxI	GGCC	2 cut(s)	4, 265
ApeKI	GCWGC	7 cut(s)	46, 49, 55, 58, 133, 232, 235
AseI	ATTAAT	1 cut(s)	113
AspS9I	GGNCC	3 cut(s)	66, 162, 259
AsuHPI	GGTGA	1 cut(s)	214
AvaII	GGWCC	3 cut(s)	66, 162, 259
BalI	TGGCCA	1 cut(s)	267
BbvCI	CCTCAGC	1 cut(s)	62
BbvI	GCAGC	7 cut(s)	33, 36, 42, 45, 145, 219, 222
BfaI	CTAG	1 cut(s)	239
BisI	GCNGC	8 cut(s)	47, 50, 53, 56, 59, 134, 233, 236
BlsI	GCNGC	8 cut(s)	48, 51, 54, 57, 60, 135, 234, 237
Bme18I	GGWCC	3 cut(s)	66, 162, 259
BmgBI	CACGTC	1 cut(s)	180
BmgT120I	GGNCC	3 cut(s)	66, 162, 259
BmiI	GGNNCC	2 cut(s)	68, 164
BmrI	ACTGGG	1 cut(s)	182
BmsI	GCATC	2 cut(s)	120, 195
BmuI	ACTGGG	1 cut(s)	182
Bpu10I	CCTNAGC	1 cut(s)	62
BsaBI	GATNNNNATC	1 cut(s)	218
BsaJI	CCNNGG	2 cut(s)	166, 262
Bsc4I	CCNNNNNNNGG	1 cut(s)	172
Bse1I	ACTGG	1 cut(s)	177
Bse8I	GATNNNNATC	1 cut(s)	218
BseDI	CCNNGG	2 cut(s)	166, 262
BseJI	GATNNNNATC	1 cut(s)	218
BseLI	CCNNNNNNNGG	1 cut(s)	172
BseMII	CTCAG	1 cut(s)	53
BseNI	ACTGG	1 cut(s)	177
BseXI	GCAGC	7 cut(s)	33, 36, 42, 45, 145, 219, 222
BshFI	GGCC	2 cut(s)	6, 267
BslFI	GGGAC	1 cut(s)	190
BslI	CCNNNNNNNGG	1 cut(s)	172
BsmFI	GGGAC	1 cut(s)	190
BsnI	GGCC	2 cut(s)	6, 267
Bsp19I	CCATGG	1 cut(s)	262
BspACI	CCGC	1 cut(s)	53
BspANI	GGCC	2 cut(s)	6, 267
BspCNI	CTCAG	1 cut(s)	54
BspLI	GGNNCC	2 cut(s)	68, 164
BsrI	ACTGG	1 cut(s)	177
BssECI	CCNNGG	2 cut(s)	166, 262
BssT1I	CCWWGG	1 cut(s)	262
Bst4CI	ACNGT	1 cut(s)	122
BstAPI	GCANNNNNTGC	1 cut(s)	232
BstDEI	CTNAG	2 cut(s)	62, 101
BstDSI	CCRYGG	1 cut(s)	262
BstMWI	GCNNNNNNNGC	6 cut(s)	52, 55, 58, 193, 232, 244
BstV1I	GCAGC	7 cut(s)	33, 36, 42, 45, 145, 219, 222
BsuRI	GGCC	2 cut(s)	6, 267
BtgI	CCRYGG	1 cut(s)	262
BtrI	CACGTC	1 cut(s)	180
BtsI	GCAGTG	1 cut(s)	41
BtsIMutI	CAGTG	1 cut(s)	41
CaiI	CAGNNNCTG	1 cut(s)	232
Cfr13I	GGNCC	3 cut(s)	66, 162, 259
CseI	GACGC	1 cut(s)	125
CviAII	CATG	2 cut(s)	190, 263
CviJI	RGCY	3 cut(s)	6, 105, 267
CviKI_1	RGCY	3 cut(s)	6, 105, 267
DdeI	CTNAG	2 cut(s)	62, 101
EaeI	YGGCCR	1 cut(s)	265
Eco130I	CCWWGG	1 cut(s)	262
Eco147I	AGGCCT	1 cut(s)	6
Eco47I	GGWCC	3 cut(s)	66, 162, 259
Eco57I	CTGAAG	2 cut(s)	218, 230
EcoO109I	RGGNCCY	1 cut(s)	66
EcoT14I	CCWWGG	1 cut(s)	262
ErhI	CCWWGG	1 cut(s)	262
FaeI	CATG	2 cut(s)	193, 266
FaiI	YATR	4 cut(s)	38, 191, 264, 282
FaqI	GGGAC	1 cut(s)	190
FatI	CATG	2 cut(s)	189, 262
Fnu4HI	GCNGC	8 cut(s)	47, 50, 53, 56, 59, 134, 233, 236
Fsp4HI	GCNGC	8 cut(s)	47, 50, 53, 56, 59, 134, 233, 236
FspBI	CTAG	1 cut(s)	239
GluI	GCNGC	8 cut(s)	47, 50, 53, 56, 59, 134, 233, 236
HaeIII	GGCC	2 cut(s)	6, 267
HgaI	GACGC	1 cut(s)	125
Hin1II	CATG	2 cut(s)	193, 266
HindIII	AAGCTT	1 cut(s)	103
HinfI	GANTC	1 cut(s)	26
HphI	GGTGA	1 cut(s)	214
Hpy188I	TCNGA	3 cut(s)	110, 141, 170
HpyAV	CCTTC	3 cut(s)	17, 193, 250
HpyCH4III	ACNGT	1 cut(s)	122
HpyCH4IV	ACGT	1 cut(s)	179
HpyCH4V	TGCA	1 cut(s)	133
HpyF10VI	GCNNNNNNNGC	6 cut(s)	52, 55, 58, 193, 232, 244
HpyF3I	CTNAG	2 cut(s)	62, 101
HpySE526I	ACGT	1 cut(s)	179
Hsp92II	CATG	2 cut(s)	193, 266
LpnPI	CCDG	2 cut(s)	95, 158
Lsp1109I	GCAGC	7 cut(s)	33, 36, 42, 45, 145, 219, 222
LweI	GCATC	2 cut(s)	120, 195
MaeI	CTAG	1 cut(s)	239
MaeII	ACGT	1 cut(s)	179
MboII	GAAGA	1 cut(s)	223
MlsI	TGGCCA	1 cut(s)	267
MluNI	TGGCCA	1 cut(s)	267
MnlI	CCTC	3 cut(s)	16, 57, 176
Mox20I	TGGCCA	1 cut(s)	267
MscI	TGGCCA	1 cut(s)	267
MseI	TTAA	2 cut(s)	86, 113
Msp20I	TGGCCA	1 cut(s)	267
MspA1I	CMGCKG	1 cut(s)	55
MwoI	GCNNNNNNNGC	6 cut(s)	52, 55, 58, 193, 232, 244
NcoI	CCATGG	1 cut(s)	262
NlaIII	CATG	2 cut(s)	193, 266
NlaIV	GGNNCC	2 cut(s)	68, 164
PceI	AGGCCT	1 cut(s)	6
PfeI	GAWTC	1 cut(s)	26
PkrI	GCNGC	8 cut(s)	48, 51, 54, 57, 60, 135, 234, 237
PpuMI	RGGWCCY	1 cut(s)	66
PshBI	ATTAAT	1 cut(s)	113
Psp5II	RGGWCCY	1 cut(s)	66
PspN4I	GGNNCC	2 cut(s)	68, 164
PspPI	GGNCC	3 cut(s)	66, 162, 259
PspPPI	RGGWCCY	1 cut(s)	66
PstNI	CAGNNNCTG	1 cut(s)	232
SaqAI	TTAA	2 cut(s)	86, 113
SatI	GCNGC	8 cut(s)	47, 50, 53, 56, 59, 134, 233, 236
Sau96I	GGNCC	3 cut(s)	66, 162, 259
SetI	ASST	4 cut(s)	84, 107, 182, 204
SfaNI	GCATC	2 cut(s)	120, 195
SgeI	CNNG	8 cut(s)	94, 179, 185, 192, 202, 235, 251, 275
SinI	GGWCC	3 cut(s)	66, 162, 259
SseBI	AGGCCT	1 cut(s)	6
SsiI	CCGC	1 cut(s)	53
SspMI	CTAG	1 cut(s)	239
StuI	AGGCCT	1 cut(s)	6
StyI	CCWWGG	1 cut(s)	262
TaaI	ACNGT	1 cut(s)	122
TaiI	ACGT	1 cut(s)	182
TauI	GCSGC	1 cut(s)	55
TfiI	GAWTC	1 cut(s)	26
Tru1I	TTAA	2 cut(s)	86, 113
Tru9I	TTAA	2 cut(s)	86, 113
TscAI	CASTG	1 cut(s)	48
TseI	GCWGC	7 cut(s)	46, 49, 55, 58, 133, 232, 235
TspRI	CASTG	1 cut(s)	48
VpaK11BI	GGWCC	3 cut(s)	66, 162, 259
VspI	ATTAAT	1 cut(s)	113
XspI	CTAG	1 cut(s)	239

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.