Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_co8051662.1

Orthogroup ID

OG0015240

Physical Location & Seq

Genomic Coordinates Forward (+)

1 .. 394

Gene Structure 394 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_co8051662.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 394 bp

ccggtccggcccagaccatgcgaagtcatgcccgattaacggctcgaagcgtacggtgtcggtttcgccggtggacgagcgtaagcggaggcggatgatatcgaaccgggagtcggcgaggcggtcgaggatgcgaaaacaaaagcacatagaaaacctaaggacacaggtcaacaggcttagaattgagaaccgggaactgaacaaccggctccggtttgtcatttaccattttcagagggtacatacggacaacgatatgctccgagccgagcacacgatgctccaacagaagttatcggacatacgccaaattttggttttccggcaactccagcacatgtcatctgtatggccatgcgataccgttattacagaacaaacgcatcactaa

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0005575 GO:0005622 GO:0005623 GO:0005634 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0044424 GO:0044464

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

bZIP_1 bZIP_2

Protein Analysis

130

Amino Acids

15.67

Weight (kDa)

11.41

Isoelectric Point (pI)

76.25

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0015240)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT3G49760
malus_domestica	MD02G1189300.v1.1 MD15G1300200.v1.1
prunus_persica	Prupe.6G217300_v2.0.a1
pyrus_communis	pycom02g15350 pycom15g26280
rosa_chinensis	RchiOBHm_Chr2g0108691
rosa_laevigata	RLG00000017685
rosa_multiflora	Rmu_co8051662.1_g000001
rosa_roxburghii	Rroxscaffold_2G00134910
rosa_rugosa	Rorug02G0155200
rosa_samantha	Rh2AG204900 Rh2BG216800 Rh2CG208000 Rh2DG211200
rosa_wichuraiana	Rw2G016320

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccB7I	CCANNNNNTGG	1 cut(s)	317
AciI	CCGC	3 cut(s)	86, 92, 122
AcoI	YGGCCR	1 cut(s)	354
AcsI	RAATTY	1 cut(s)	313
AfaI	GTAC	2 cut(s)	53, 244
AfiI	CCNNNNNNNGG	3 cut(s)	39, 113, 317
AflIII	ACRYGT	1 cut(s)	340
Alw21I	GWGCWC	1 cut(s)	277
AoxI	GGCC	2 cut(s)	8, 354
ApoI	RAATTY	1 cut(s)	313
ArsI	GACNNNNNNTTYG	2 cut(s)	96, 128
AspS9I	GGNCC	2 cut(s)	4, 9
AsuC2I	CCSGG	2 cut(s)	108, 195
AvaII	GGWCC	1 cut(s)	4
AxyI	CCTNAGG	1 cut(s)	159
BalI	TGGCCA	1 cut(s)	356
Bbv12I	GWGCWC	1 cut(s)	277
BceAI	ACGGC	1 cut(s)	56
BcnI	CCSGG	2 cut(s)	108, 195
Bme1390I	CCNGG	2 cut(s)	108, 195
Bme18I	GGWCC	1 cut(s)	4
BmgT120I	GGNCC	2 cut(s)	4, 9
BmiI	GGNNCC	1 cut(s)	213
BmrFI	CCNGG	2 cut(s)	108, 195
BmsI	GCATC	2 cut(s)	121, 271
BoxI	GACNNNNGTC	1 cut(s)	168
BpmI	CTGGAG	1 cut(s)	318
BpuMI	CCSGG	2 cut(s)	108, 195
BsaWI	WCCGGW	1 cut(s)	214
Bsc4I	CCNNNNNNNGG	3 cut(s)	39, 113, 317
Bse118I	RCCGGY	2 cut(s)	68, 208
Bse21I	CCTNAGG	1 cut(s)	159
BseGI	GGATG	2 cut(s)	100, 136
BseLI	CCNNNNNNNGG	3 cut(s)	39, 113, 317
Bsh1285I	CGRYCG	1 cut(s)	126
BshFI	GGCC	2 cut(s)	10, 356
BsiEI	CGRYCG	1 cut(s)	126
BsiHKAI	GWGCWC	1 cut(s)	277
BsiSI	CCGG	8 cut(s)	2, 7, 69, 107, 194, 209, 215, 326
BsiWI	CGTACG	1 cut(s)	51
BslI	CCNNNNNNNGG	3 cut(s)	39, 113, 317
BsnI	GGCC	2 cut(s)	10, 356
Bsp1286I	GDGCHC	1 cut(s)	277
BspACI	CCGC	3 cut(s)	86, 92, 122
BspANI	GGCC	2 cut(s)	10, 356
BspLI	GGNNCC	1 cut(s)	213
BsrFI	RCCGGY	2 cut(s)	68, 208
BssAI	RCCGGY	2 cut(s)	68, 208
Bst4CI	ACNGT	2 cut(s)	56, 368
BstAPI	GCANNNNNTGC	1 cut(s)	281
BstDEI	CTNAG	2 cut(s)	159, 180
BstF5I	GGATG	2 cut(s)	100, 136
BstMCI	CGRYCG	1 cut(s)	126
BstMWI	GCNNNNNNNGC	2 cut(s)	281, 335
BstNSI	RCATGY	1 cut(s)	344
BstPAI	GACNNNNGTC	1 cut(s)	168
BstSCI	CCNGG	2 cut(s)	106, 193
Bsu36I	CCTNAGG	1 cut(s)	159
BsuRI	GGCC	2 cut(s)	10, 356
BtsCI	GGATG	2 cut(s)	100, 136
Cfr10I	RCCGGY	2 cut(s)	68, 208
Cfr13I	GGNCC	2 cut(s)	4, 9
CpoI	CGGWCCG	1 cut(s)	4
Csp6I	GTAC	2 cut(s)	52, 243
CspI	CGGWCCG	1 cut(s)	4
CviAII	CATG	4 cut(s)	18, 28, 341, 358
CviJI	RGCY	6 cut(s)	10, 43, 179, 212, 270, 356
CviKI_1	RGCY	6 cut(s)	10, 43, 179, 212, 270, 356
CviQI	GTAC	2 cut(s)	52, 243
DdeI	CTNAG	2 cut(s)	159, 180
EaeI	YGGCCR	1 cut(s)	354
EciI	GGCGGA	1 cut(s)	107
Eco32I	GATATC	1 cut(s)	100
Eco47I	GGWCC	1 cut(s)	4
Eco81I	CCTNAGG	1 cut(s)	159
EcoRV	GATATC	1 cut(s)	100
FaeI	CATG	4 cut(s)	21, 31, 344, 361
FaiI	YATR	9 cut(s)	19, 29, 150, 247, 261, 306, 342, 353, 359
FatI	CATG	4 cut(s)	17, 27, 340, 357
FokI	GGATG	2 cut(s)	107, 143
GsuI	CTGGAG	1 cut(s)	318
HaeIII	GGCC	2 cut(s)	10, 356
HapII	CCGG	8 cut(s)	2, 7, 69, 107, 194, 209, 215, 326
Hin1II	CATG	4 cut(s)	21, 31, 344, 361
HincII	GTYRAC	1 cut(s)	173
HindII	GTYRAC	1 cut(s)	173
HinfI	GANTC	1 cut(s)	111
HpaII	CCGG	8 cut(s)	2, 7, 69, 107, 194, 209, 215, 326
Hpy166II	GTNNAC	2 cut(s)	74, 173
Hpy188I	TCNGA	3 cut(s)	238, 267, 302
Hpy8I	GTNNAC	2 cut(s)	74, 173
HpyCH4III	ACNGT	2 cut(s)	56, 368
HpyF10VI	GCNNNNNNNGC	2 cut(s)	281, 335
HpyF3I	CTNAG	2 cut(s)	159, 180
Hsp92II	CATG	4 cut(s)	21, 31, 344, 361
LmnI	GCTCC	3 cut(s)	217, 268, 289
LweI	GCATC	2 cut(s)	121, 271
MhlI	GDGCHC	1 cut(s)	277
MlsI	TGGCCA	1 cut(s)	356
MluCI	AATT	2 cut(s)	184, 313
MluNI	TGGCCA	1 cut(s)	356
MlyI	GAGTC	1 cut(s)	120
MmeI	TCCRAC	1 cut(s)	311
MnlI	CCTC	4 cut(s)	82, 112, 121, 232
Mox20I	TGGCCA	1 cut(s)	356
MscI	TGGCCA	1 cut(s)	356
MseI	TTAA	1 cut(s)	37
MslI	CAYNNNNRTG	1 cut(s)	350
Msp20I	TGGCCA	1 cut(s)	356
MspI	CCGG	8 cut(s)	2, 7, 69, 107, 194, 209, 215, 326
MspR9I	CCNGG	2 cut(s)	108, 195
MwoI	GCNNNNNNNGC	2 cut(s)	281, 335
NciI	CCSGG	2 cut(s)	108, 195
NlaIII	CATG	4 cut(s)	21, 31, 344, 361
NlaIV	GGNNCC	1 cut(s)	213
NmeAIII	GCCGAG	1 cut(s)	296
NspI	RCATGY	1 cut(s)	344
PciI	ACATGT	1 cut(s)	340
Pfl23II	CGTACG	1 cut(s)	51
PflMI	CCANNNNNTGG	1 cut(s)	317
PleI	GAGTC	1 cut(s)	119
PpsI	GAGTC	1 cut(s)	119
PscI	ACATGT	1 cut(s)	340
PshAI	GACNNNNGTC	1 cut(s)	168
PspLI	CGTACG	1 cut(s)	51
PspN4I	GGNNCC	1 cut(s)	213
PspPI	GGNCC	2 cut(s)	4, 9
RsaI	GTAC	2 cut(s)	53, 244
RsaNI	GTAC	2 cut(s)	52, 243
RseI	CAYNNNNRTG	1 cut(s)	350
Rsr2I	CGGWCCG	1 cut(s)	4
RsrII	CGGWCCG	1 cut(s)	4
SaqAI	TTAA	1 cut(s)	37
Sau96I	GGNCC	2 cut(s)	4, 9
SchI	GAGTC	1 cut(s)	120
ScrFI	CCNGG	2 cut(s)	108, 195
SduI	GDGCHC	1 cut(s)	277
SetI	ASST	2 cut(s)	160, 172
SfaNI	GCATC	2 cut(s)	121, 271
SgrAI	CRCCGGYG	1 cut(s)	68
SinI	GGWCC	1 cut(s)	4
SmiMI	CAYNNNNRTG	1 cut(s)	350
Sse9I	AATT	2 cut(s)	184, 313
SsiI	CCGC	3 cut(s)	86, 92, 122
StyD4I	CCNGG	2 cut(s)	106, 193
TaaI	ACNGT	2 cut(s)	56, 368
TaqI	TCGA	3 cut(s)	45, 102, 126
TasI	AATT	2 cut(s)	184, 313
Tru1I	TTAA	1 cut(s)	37
Tru9I	TTAA	1 cut(s)	37
TspGWI	ACGGA	1 cut(s)	264
Van91I	CCANNNNNTGG	1 cut(s)	317
VpaK11BI	GGWCC	1 cut(s)	4
XapI	RAATTY	1 cut(s)	313
XceI	RCATGY	1 cut(s)	344

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.