Rmu_co8054622.1_g000001

NADH dehydrogenase (ubiquinone) complex I, assembly factor

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8054622.1
OG0015411
Physical Location & Seq
Forward (+)
11 .. 563
553 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8054622.1_g000001.1.cds

Sequence Viewer

Length: 553 bp
atgaataatgcttcagcatccagtagtttaagagcagctttctcacactgtgtgcagcaagtccgaaattatgattaccatcactacctttgcctccttgaactcccccataacatgcggaaggctgcatttgcagtccgtgccttgaatgttgaaacagctcgtgcaatggatgttgcttctgatcccaggattggtcttatgcgtcttgtctggtggcaagaagccatagacaaaatctatgccaacaagtcgattgagcacccaacagcacaagccctcttgtcagtcgtccatgagaacaaaattagcaagggatggttgaaacggtctgtagaagctcgcatcaatgatgcaagaaaggagattggtgatgccccagaaaaaattgaagacttggaaaaatatgctgaagacaccatgtcaactaatctttacatgacactacaagctggtggtatcaggtccacggcagccgatcatgcagcatcacatattggaaaagcaagtgggcttcttctgctaattaagtcactgccataccatgctaacc
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko04714 map04714
Pfam Domains
Protein Families
SQS_PSY

Protein Analysis

184

Amino Acids

20.54

Weight (kDa)

8.51

Isoelectric Point (pI)

48.82

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0015411)

Species Orthologous Gene IDs
arabidopsis_thaliana AT1G62730 AT1G62730
fragaria_vesca FvH4_5g00371
malus_domestica MD04G1082000.v1.1
prunus_persica Prupe.5G076400_v2.0.a1
pyrus_communis pycom04g07390
rosa_chinensis RchiOBHm_Chr7g0202141
rosa_laevigata RLG00000003622
rosa_multiflora Rmu_co8054622.1_g000001
rosa_roxburghii Rroxscaffold_3G00254810
rosa_rugosa Rorug07G0068400
rosa_samantha Rh7AG195800 Rh7BG197100 Rh7CG206900 Rh7DG202400
rosa_wichuraiana Rw7G017150

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 118
AclWI GGATC 1 cut(s) 179
AcuI CTGAAG 1 cut(s) 432
AdeI CACNNNGTG 2 cut(s) 50, 52
AfiI CCNNNNNNNGG 1 cut(s) 194
AgsI TTSAA 5 cut(s) 101, 148, 155, 325, 392
AhdI GACNNNNNGTC 1 cut(s) 421
AjnI CCWGG 1 cut(s) 188
AluBI AGCT 4 cut(s) 38, 161, 341, 452
AluI AGCT 4 cut(s) 38, 161, 341, 452
Alw21I GWGCWC 1 cut(s) 264
AlwI GGATC 1 cut(s) 179
ApeKI GCWGC 5 cut(s) 35, 55, 125, 473, 485
AspS9I GGNCC 1 cut(s) 465
AsuHPI GGTGA 1 cut(s) 383
AvaII GGWCC 1 cut(s) 465
BauI CACGAG 1 cut(s) 162
BbsI GAAGAC 2 cut(s) 399, 420
Bbv12I GWGCWC 1 cut(s) 264
BbvI GCAGC 5 cut(s) 47, 67, 112, 485, 497
BccI CCATC 2 cut(s) 87, 312
BceAI ACGGC 1 cut(s) 486
BciT130I CCWGG 1 cut(s) 190
BfmI CTRYAG 1 cut(s) 333
BisI GCNGC 5 cut(s) 36, 56, 126, 474, 486
BlsI GCNGC 5 cut(s) 37, 57, 127, 475, 487
Bme1390I CCNGG 1 cut(s) 190
Bme18I GGWCC 1 cut(s) 465
BmeRI GACNNNNNGTC 1 cut(s) 421
BmgT120I GGNCC 1 cut(s) 465
BmrFI CCNGG 1 cut(s) 190
BmsI GCATC 5 cut(s) 26, 343, 354, 364, 497
BpiI GAAGAC 2 cut(s) 399, 420
BsaBI GATNNNNATC 1 cut(s) 78
BsaJI CCNNGG 2 cut(s) 188, 468
Bsc4I CCNNNNNNNGG 1 cut(s) 194
Bse1I ACTGG 1 cut(s) 21
Bse3DI GCAATG 1 cut(s) 174
Bse8I GATNNNNATC 1 cut(s) 78
BseBI CCWGG 1 cut(s) 190
BseDI CCNNGG 2 cut(s) 188, 468
BseGI GGATG 3 cut(s) 17, 178, 323
BseJI GATNNNNATC 1 cut(s) 78
BseLI CCNNNNNNNGG 1 cut(s) 194
BseMI GCAATG 1 cut(s) 174
BseNI ACTGG 1 cut(s) 21
BseXI GCAGC 5 cut(s) 47, 67, 112, 485, 497
BsgI GTGCAG 1 cut(s) 74
BsiHKAI GWGCWC 1 cut(s) 264
BslI CCNNNNNNNGG 1 cut(s) 194
Bsp1286I GDGCHC 1 cut(s) 264
Bsp143I GATC 2 cut(s) 184, 478
BspACI CCGC 1 cut(s) 118
BspPI GGATC 1 cut(s) 179
BsrDI GCAATG 1 cut(s) 174
BsrI ACTGG 1 cut(s) 21
BssECI CCNNGG 2 cut(s) 188, 468
BssMI GATC 2 cut(s) 184, 478
BssSI CACGAG 1 cut(s) 162
Bst2BI CACGAG 1 cut(s) 162
Bst2UI CCWGG 1 cut(s) 190
Bst4CI ACNGT 2 cut(s) 50, 330
BstAPI GCANNNNNTGC 1 cut(s) 140
BstC8I GCNNGC 1 cut(s) 343
BstDSI CCRYGG 1 cut(s) 468
BstF5I GGATG 3 cut(s) 17, 178, 323
BstKTI GATC 2 cut(s) 187, 481
BstMBI GATC 2 cut(s) 184, 478
BstMWI GCNNNNNNNGC 4 cut(s) 131, 140, 482, 520
BstNI CCWGG 1 cut(s) 190
BstNSI RCATGY 1 cut(s) 118
BstSCI CCNGG 1 cut(s) 188
BstSFI CTRYAG 1 cut(s) 333
BstV1I GCAGC 5 cut(s) 47, 67, 112, 485, 497
BstV2I GAAGAC 2 cut(s) 399, 420
BtgI CCRYGG 1 cut(s) 468
BtsCI GGATG 3 cut(s) 17, 178, 323
BtsI GCAGTG 1 cut(s) 533
BtsIMutI CAGTG 2 cut(s) 46, 533
Cac8I GCNNGC 1 cut(s) 343
Cfr13I GGNCC 1 cut(s) 465
CseI GACGC 1 cut(s) 194
CviAII CATG 6 cut(s) 115, 296, 421, 439, 482, 545
CviJI RGCY 9 cut(s) 38, 125, 161, 227, 278, 341, 452, 476, 514
CviKI_1 RGCY 9 cut(s) 38, 125, 161, 227, 278, 341, 452, 476, 514
DpnI GATC 2 cut(s) 186, 480
DpnII GATC 2 cut(s) 184, 478
DraIII CACNNNGTG 2 cut(s) 50, 52
DriI GACNNNNNGTC 1 cut(s) 421
Eam1105I GACNNNNNGTC 1 cut(s) 421
Eco47I GGWCC 1 cut(s) 465
Eco57I CTGAAG 1 cut(s) 432
EcoRII CCWGG 1 cut(s) 188
FaeI CATG 6 cut(s) 118, 299, 424, 442, 485, 548
FalI AAGNNNNNCTT 2 cut(s) 22, 54
FatI CATG 6 cut(s) 114, 295, 420, 438, 481, 544
Fnu4HI GCNGC 5 cut(s) 36, 56, 126, 474, 486
FokI GGATG 3 cut(s) 4, 185, 330
Fsp4HI GCNGC 5 cut(s) 36, 56, 126, 474, 486
GluI GCNGC 5 cut(s) 36, 56, 126, 474, 486
HgaI GACGC 1 cut(s) 194
Hin1II CATG 6 cut(s) 118, 299, 424, 442, 485, 548
HincII GTYRAC 1 cut(s) 426
HindII GTYRAC 1 cut(s) 426
HphI GGTGA 1 cut(s) 383
Hpy166II GTNNAC 2 cut(s) 426, 468
Hpy188I TCNGA 2 cut(s) 65, 184
Hpy8I GTNNAC 2 cut(s) 426, 468
HpyAV CCTTC 1 cut(s) 115
HpyCH4III ACNGT 2 cut(s) 50, 330
HpyCH4V TGCA 6 cut(s) 55, 128, 134, 167, 356, 485
HpyF10VI GCNNNNNNNGC 4 cut(s) 131, 140, 482, 520
Hsp92II CATG 6 cut(s) 118, 299, 424, 442, 485, 548
Kzo9I GATC 2 cut(s) 184, 478
LpnPI CCDG 7 cut(s) 34, 175, 199, 202, 393, 438, 448
Lsp1109I GCAGC 5 cut(s) 47, 67, 112, 485, 497
LweI GCATC 5 cut(s) 26, 343, 354, 364, 497
MaeIII GTNAC 1 cut(s) 531
MalI GATC 2 cut(s) 186, 480
MboI GATC 2 cut(s) 184, 478
MboII GAAGA 3 cut(s) 404, 425, 509
MhlI GDGCHC 1 cut(s) 264
MluCI AATT 4 cut(s) 67, 306, 387, 525
MnlI CCTC 2 cut(s) 104, 290
MseI TTAA 2 cut(s) 29, 528
MspR9I CCNGG 1 cut(s) 190
MvaI CCWGG 1 cut(s) 190
MwoI GCNNNNNNNGC 4 cut(s) 131, 140, 482, 520
NdeII GATC 2 cut(s) 184, 478
NlaIII CATG 6 cut(s) 118, 299, 424, 442, 485, 548
NmuCI GTSAC 1 cut(s) 531
NspI RCATGY 1 cut(s) 118
PkrI GCNGC 5 cut(s) 37, 57, 127, 475, 487
Psp6I CCWGG 1 cut(s) 188
PspGI CCWGG 1 cut(s) 188
PspPI GGNCC 1 cut(s) 465
SaqAI TTAA 2 cut(s) 29, 528
SatI GCNGC 5 cut(s) 36, 56, 126, 474, 486
Sau3AI GATC 2 cut(s) 184, 478
Sau96I GGNCC 1 cut(s) 465
ScrFI CCNGG 1 cut(s) 190
SduI GDGCHC 1 cut(s) 264
SetI ASST 6 cut(s) 40, 90, 163, 343, 454, 467
SfaNI GCATC 5 cut(s) 26, 343, 354, 364, 497
SfcI CTRYAG 1 cut(s) 333
SinI GGWCC 1 cut(s) 465
Sse9I AATT 4 cut(s) 67, 306, 387, 525
SsiI CCGC 1 cut(s) 118
StyD4I CCNGG 1 cut(s) 188
TaaI ACNGT 2 cut(s) 50, 330
TaqI TCGA 1 cut(s) 254
TasI AATT 4 cut(s) 67, 306, 387, 525
Tru1I TTAA 2 cut(s) 29, 528
Tru9I TTAA 2 cut(s) 29, 528
TscAI CASTG 2 cut(s) 53, 540
TseFI GTSAC 1 cut(s) 531
TseI GCWGC 5 cut(s) 35, 55, 125, 473, 485
Tsp45I GTSAC 1 cut(s) 531
TspDTI ATGAA 1 cut(s) 17
TspGWI ACGGA 1 cut(s) 128
TspRI CASTG 2 cut(s) 53, 540
VpaK11BI GGWCC 1 cut(s) 465
XceI RCATGY 1 cut(s) 118
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.