Rmu_co8101556.1_g000001

Ring finger

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8101556.1
OG0008874
Physical Location & Seq
Reverse (-)
1 .. 536
536 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8101556.1_g000001.1.cds

Sequence Viewer

Length: 468 bp
atgattcctcatagtgtggtcaatgcttcctccaaagtctgcgagtttcaaaagccttatgttgatagggaattggtatctggtgtaggttcagctgcagccttaaatagtattcagcaggatggagagttagatagtgatataagcaggcctcagctaattgataacttcactggtgatggaggtagcacccctatgtcatggtccacattagatgatgtagaaattgtgataaataacaatctcttgattagtggaggtcaagaggaccatccagaaaggcttgatgggagttgcctaacccttggaattggatgccagtcaaatgatttatcaggaagaaatgttggttatgattctgaaagggctgtccttcctcagtcgaacatatttcacagtcaaaacgccaacagaagtttgcatcatttccctgaagtagctgctggtttttcttgcgttcagaacaat
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

156

Amino Acids

16.74

Weight (kDa)

4.49

Isoelectric Point (pI)

45.64

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcuI CTGAAG 1 cut(s) 453
AgsI TTSAA 1 cut(s) 50
AluBI AGCT 3 cut(s) 95, 157, 440
AluI AGCT 3 cut(s) 95, 157, 440
AoxI GGCC 1 cut(s) 149
ApeKI GCWGC 3 cut(s) 95, 98, 440
AspS9I GGNCC 2 cut(s) 204, 268
AsuHPI GGTGA 1 cut(s) 188
AvaII GGWCC 2 cut(s) 204, 268
BbvCI CCTCAGC 1 cut(s) 153
BbvI GCAGC 3 cut(s) 82, 110, 427
BccI CCATC 4 cut(s) 116, 173, 279, 281
BfmI CTRYAG 1 cut(s) 96
BisI GCNGC 3 cut(s) 96, 99, 441
BlsI GCNGC 3 cut(s) 97, 100, 442
Bme18I GGWCC 2 cut(s) 204, 268
BmgT120I GGNCC 2 cut(s) 204, 268
BmsI GCATC 2 cut(s) 305, 430
Bpu10I CCTNAGC 1 cut(s) 153
BsaJI CCNNGG 1 cut(s) 304
Bse1I ACTGG 2 cut(s) 178, 319
BseDI CCNNGG 1 cut(s) 304
BseGI GGATG 3 cut(s) 127, 271, 320
BseMII CTCAG 2 cut(s) 167, 392
BseNI ACTGG 2 cut(s) 178, 319
BseXI GCAGC 3 cut(s) 82, 110, 427
BshFI GGCC 1 cut(s) 151
BsnI GGCC 1 cut(s) 151
BspANI GGCC 1 cut(s) 151
BspCNI CTCAG 2 cut(s) 166, 391
BspMAI CTGCAG 1 cut(s) 100
BsrI ACTGG 2 cut(s) 178, 319
BssECI CCNNGG 1 cut(s) 304
BssT1I CCWWGG 1 cut(s) 304
Bst4CI ACNGT 1 cut(s) 398
BstC8I GCNNGC 1 cut(s) 149
BstDEI CTNAG 2 cut(s) 153, 378
BstF5I GGATG 3 cut(s) 127, 271, 320
BstSFI CTRYAG 1 cut(s) 96
BstV1I GCAGC 3 cut(s) 82, 110, 427
BsuRI GGCC 1 cut(s) 151
BtsCI GGATG 3 cut(s) 127, 271, 320
BtsIMutI CAGTG 1 cut(s) 171
Cac8I GCNNGC 1 cut(s) 149
Cfr13I GGNCC 2 cut(s) 204, 268
CviAII CATG 1 cut(s) 201
CviJI RGCY 8 cut(s) 55, 95, 101, 151, 157, 283, 368, 440
CviKI_1 RGCY 8 cut(s) 55, 95, 101, 151, 157, 283, 368, 440
DdeI CTNAG 2 cut(s) 153, 378
Eco130I CCWWGG 1 cut(s) 304
Eco147I AGGCCT 1 cut(s) 151
Eco47I GGWCC 2 cut(s) 204, 268
Eco57I CTGAAG 1 cut(s) 453
EcoT14I CCWWGG 1 cut(s) 304
ErhI CCWWGG 1 cut(s) 304
FaeI CATG 1 cut(s) 204
FaiI YATR 7 cut(s) 12, 60, 143, 197, 202, 354, 389
FatI CATG 1 cut(s) 200
Fnu4HI GCNGC 3 cut(s) 96, 99, 441
FokI GGATG 3 cut(s) 134, 258, 327
Fsp4HI GCNGC 3 cut(s) 96, 99, 441
GluI GCNGC 3 cut(s) 96, 99, 441
HaeIII GGCC 1 cut(s) 151
Hin1II CATG 1 cut(s) 204
HinfI GANTC 2 cut(s) 4, 356
HphI GGTGA 1 cut(s) 188
Hpy166II GTNNAC 1 cut(s) 207
Hpy188I TCNGA 2 cut(s) 361, 462
Hpy188III TCNNGA 4 cut(s) 247, 263, 275, 336
Hpy8I GTNNAC 1 cut(s) 207
HpyAV CCTTC 1 cut(s) 383
HpyCH4III ACNGT 1 cut(s) 398
HpyCH4V TGCA 2 cut(s) 98, 421
HpyF3I CTNAG 2 cut(s) 153, 378
Hsp92II CATG 1 cut(s) 204
LpnPI CCDG 9 cut(s) 66, 104, 133, 159, 288, 321, 332, 429, 444
Lsp1109I GCAGC 3 cut(s) 82, 110, 427
LweI GCATC 2 cut(s) 305, 430
MboII GAAGA 1 cut(s) 351
MluCI AATT 4 cut(s) 71, 159, 225, 309
MnlI CCTC 7 cut(s) 18, 40, 162, 176, 251, 259, 387
MseI TTAA 1 cut(s) 104
MslI CAYNNNNRTG 1 cut(s) 194
MspA1I CMGCKG 1 cut(s) 95
NlaIII CATG 1 cut(s) 204
PceI AGGCCT 1 cut(s) 151
PfeI GAWTC 2 cut(s) 4, 356
PkrI GCNGC 3 cut(s) 97, 100, 442
PspPI GGNCC 2 cut(s) 204, 268
PstI CTGCAG 1 cut(s) 100
PvuII CAGCTG 1 cut(s) 95
RseI CAYNNNNRTG 1 cut(s) 194
SaqAI TTAA 1 cut(s) 104
SatI GCNGC 3 cut(s) 96, 99, 441
Sau96I GGNCC 2 cut(s) 204, 268
SetI ASST 6 cut(s) 91, 97, 159, 187, 262, 442
SfaNI GCATC 2 cut(s) 305, 430
SfcI CTRYAG 1 cut(s) 96
SinI GGWCC 2 cut(s) 204, 268
SmiMI CAYNNNNRTG 1 cut(s) 194
Sse9I AATT 4 cut(s) 71, 159, 225, 309
SseBI AGGCCT 1 cut(s) 151
StuI AGGCCT 1 cut(s) 151
StyI CCWWGG 1 cut(s) 304
TaaI ACNGT 1 cut(s) 398
TaqI TCGA 1 cut(s) 383
TasI AATT 4 cut(s) 71, 159, 225, 309
TfiI GAWTC 2 cut(s) 4, 356
Tru1I TTAA 1 cut(s) 104
Tru9I TTAA 1 cut(s) 104
TscAI CASTG 1 cut(s) 178
TseI GCWGC 3 cut(s) 95, 98, 440
TspRI CASTG 1 cut(s) 178
VpaK11BI GGWCC 2 cut(s) 204, 268
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.