Rmu_co8131344.1_g000001

Protein FAR1-RELATED SEQUENCE

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8131344.1
Physical Location & Seq
Forward (+)
156 .. 629
474 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8131344.1_g000001.1.cds

Sequence Viewer

Length: 474 bp
atgcaagtgtggactgaacactatgtcatggaggtagaggtttccagtgaagaagtagtggactcttatgtgtcgttggaagacgaaggctatgaacattgtgttgtagaggacgtcgaagttcgggtggtgttggatgatgtcaaagaggataatggggatattgatttggtgcagtatatggcaggtggcgataatggtgggattatagagcccacattggacatggagtttgattccgaagatgatgcgaggaatttctataatgcatatgctaaacacattggatttagtattcgagtgaattcttattatcgttcgaagaaggataattcgattatatctagagagttttgttgttccaaagaggggttttgcagagagagacgtgctaagaatgattctagtgatggtgcaaaaacgaggcgtgctaggggcctagggccatcactagggaaggtttcaaggcactga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

157

Amino Acids

17.86

Weight (kDa)

4.69

Isoelectric Point (pI)

49.81

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0018518)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AarI CACCTGC 1 cut(s) 176
AatII GACGTC 1 cut(s) 117
Acc36I ACCTGC 1 cut(s) 176
AcsI RAATTY 2 cut(s) 256, 304
AcyI GRCGYC 1 cut(s) 114
AfiI CCNNNNNNNGG 2 cut(s) 369, 452
AgsI TTSAA 1 cut(s) 465
AjiI CACGTC 1 cut(s) 389
Alw26I GTCTC 1 cut(s) 379
AoxI GGCC 2 cut(s) 436, 443
ApoI RAATTY 2 cut(s) 256, 304
ArsI GACNNNNNNTTYG 2 cut(s) 215, 247
AspA2I CCTAGG 1 cut(s) 439
AspS9I GGNCC 2 cut(s) 436, 443
AsuII TTCGAA 1 cut(s) 320
AvrII CCTAGG 1 cut(s) 439
BanII GRGCYC 1 cut(s) 216
BbsI GAAGAC 1 cut(s) 87
BccI CCATC 2 cut(s) 404, 454
BcgI CGANNNNNNTGC 2 cut(s) 230, 264
BcoDI GTCTC 1 cut(s) 379
BfaI CTAG 5 cut(s) 345, 405, 432, 440, 452
BfuAI ACCTGC 1 cut(s) 176
BlnI CCTAGG 1 cut(s) 439
BmgBI CACGTC 1 cut(s) 389
BmgT120I GGNCC 2 cut(s) 436, 443
BmiI GGNNCC 1 cut(s) 437
BmsI GCATC 1 cut(s) 238
BpiI GAAGAC 1 cut(s) 87
Bpu14I TTCGAA 1 cut(s) 320
BsaHI GRCGYC 1 cut(s) 114
BsaJI CCNNGG 1 cut(s) 439
Bsc4I CCNNNNNNNGG 2 cut(s) 369, 452
Bse1I ACTGG 1 cut(s) 45
BseDI CCNNGG 1 cut(s) 439
BseGI GGATG 1 cut(s) 142
BseLI CCNNNNNNNGG 2 cut(s) 369, 452
BseNI ACTGG 1 cut(s) 45
BsgI GTGCAG 1 cut(s) 194
BshFI GGCC 2 cut(s) 438, 445
BslI CCNNNNNNNGG 2 cut(s) 369, 452
BsmAI GTCTC 1 cut(s) 379
BsmBI CGTCTC 1 cut(s) 379
BsnI GGCC 2 cut(s) 438, 445
Bsp119I TTCGAA 1 cut(s) 320
Bsp1286I GDGCHC 1 cut(s) 216
BspANI GGCC 2 cut(s) 438, 445
BspLI GGNNCC 1 cut(s) 437
BspMI ACCTGC 1 cut(s) 176
BspT104I TTCGAA 1 cut(s) 320
BsrI ACTGG 1 cut(s) 45
BssECI CCNNGG 1 cut(s) 439
BssNI GRCGYC 1 cut(s) 114
BssT1I CCWWGG 1 cut(s) 439
BstACI GRCGYC 1 cut(s) 114
BstBI TTCGAA 1 cut(s) 320
BstC8I GCNNGC 1 cut(s) 429
BstDEI CTNAG 1 cut(s) 393
BstF5I GGATG 1 cut(s) 142
BstMAI GTCTC 1 cut(s) 379
BstV2I GAAGAC 1 cut(s) 87
BsuRI GGCC 2 cut(s) 438, 445
BtrI CACGTC 1 cut(s) 389
BtsCI GGATG 1 cut(s) 142
BtsIMutI CAGTG 2 cut(s) 52, 469
BveI ACCTGC 1 cut(s) 176
Cac8I GCNNGC 1 cut(s) 429
Cfr13I GGNCC 2 cut(s) 436, 443
CviAII CATG 2 cut(s) 28, 226
CviJI RGCY 4 cut(s) 90, 214, 438, 445
CviKI_1 RGCY 4 cut(s) 90, 214, 438, 445
DdeI CTNAG 1 cut(s) 393
Eco130I CCWWGG 1 cut(s) 439
Eco24I GRGCYC 1 cut(s) 216
EcoO109I RGGNCCY 1 cut(s) 436
EcoRI GAATTC 1 cut(s) 304
EcoT14I CCWWGG 1 cut(s) 439
EcoT22I ATGCAT 1 cut(s) 271
EcoT38I GRGCYC 1 cut(s) 216
ErhI CCWWGG 1 cut(s) 439
Esp3I CGTCTC 1 cut(s) 379
FaeI CATG 2 cut(s) 31, 229
FatI CATG 2 cut(s) 27, 225
FauNDI CATATG 1 cut(s) 271
FokI GGATG 1 cut(s) 149
FriOI GRGCYC 1 cut(s) 216
FspBI CTAG 5 cut(s) 345, 405, 432, 440, 452
HaeIII GGCC 2 cut(s) 438, 445
Hin1I GRCGYC 1 cut(s) 114
Hin1II CATG 2 cut(s) 31, 229
HinfI GANTC 3 cut(s) 62, 236, 401
Hpy166II GTNNAC 2 cut(s) 12, 61
Hpy188I TCNGA 1 cut(s) 241
Hpy188III TCNNGA 1 cut(s) 345
Hpy8I GTNNAC 2 cut(s) 12, 61
Hpy99I CGWCG 1 cut(s) 119
HpyAV CCTTC 3 cut(s) 80, 319, 451
HpyCH4IV ACGT 2 cut(s) 114, 388
HpyCH4V TGCA 5 cut(s) 4, 175, 269, 378, 416
HpyF3I CTNAG 1 cut(s) 393
HpySE526I ACGT 2 cut(s) 114, 388
Hsp92I GRCGYC 1 cut(s) 114
Hsp92II CATG 2 cut(s) 31, 229
LpnPI CCDG 2 cut(s) 58, 171
LweI GCATC 1 cut(s) 238
MaeI CTAG 5 cut(s) 345, 405, 432, 440, 452
MaeII ACGT 2 cut(s) 114, 388
MboII GAAGA 4 cut(s) 62, 92, 254, 334
MhlI GDGCHC 1 cut(s) 216
MluCI AATT 3 cut(s) 256, 304, 331
MlyI GAGTC 1 cut(s) 56
MmeI TCCRAC 2 cut(s) 57, 114
MnlI CCTC 7 cut(s) 25, 31, 103, 142, 246, 361, 417
Mph1103I ATGCAT 1 cut(s) 271
NdeI CATATG 1 cut(s) 271
NlaIII CATG 2 cut(s) 31, 229
NlaIV GGNNCC 1 cut(s) 437
NsiI ATGCAT 1 cut(s) 271
NspV TTCGAA 1 cut(s) 320
PaqCI CACCTGC 1 cut(s) 176
PfeI GAWTC 2 cut(s) 236, 401
PleI GAGTC 1 cut(s) 56
PpsI GAGTC 1 cut(s) 56
PspN4I GGNNCC 1 cut(s) 437
PspPI GGNCC 2 cut(s) 436, 443
Sau96I GGNCC 2 cut(s) 436, 443
SchI GAGTC 1 cut(s) 56
SduI GDGCHC 1 cut(s) 216
SetI ASST 6 cut(s) 36, 42, 117, 190, 391, 462
SfaNI GCATC 1 cut(s) 238
SfuI TTCGAA 1 cut(s) 320
Sse9I AATT 3 cut(s) 256, 304, 331
SspMI CTAG 5 cut(s) 345, 405, 432, 440, 452
StyI CCWWGG 1 cut(s) 439
TaiI ACGT 2 cut(s) 117, 391
TaqI TCGA 4 cut(s) 117, 298, 320, 335
TasI AATT 3 cut(s) 256, 304, 331
TfiI GAWTC 2 cut(s) 236, 401
TscAI CASTG 1 cut(s) 52
TspDTI ATGAA 1 cut(s) 108
TspRI CASTG 1 cut(s) 52
XapI RAATTY 2 cut(s) 256, 304
XbaI TCTAGA 1 cut(s) 344
XcmI CCANNNNNNNNNTGG 1 cut(s) 223
XmaJI CCTAGG 1 cut(s) 439
XspI CTAG 5 cut(s) 345, 405, 432, 440, 452
ZraI GACGTC 1 cut(s) 115
Zsp2I ATGCAT 1 cut(s) 271
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.