Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_co8143572.1

Orthogroup ID

OG0015043

Physical Location & Seq

Genomic Coordinates Reverse (-)

2 .. 479

Gene Structure 478 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_co8143572.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 478 bp

atggatcaaatgtacctatcaggaggtttggttgcaactgatgatatgggggttttactacttgctggctccactgttggtggaggctctacaatcaactggtcagcctcaattctaacacctcagcatgtaagtagcgaatggtacaatcaccatgggctagaactgttcgacagtcaactatatcaagaagccatggatattgtctgccaacgaatgggagttcaatctgacatacatgaagaaggattcaacaatgctgttttgagaagagggtgccaagaattggggtatcctgtacataatattcctcgaaacgcaggaccatatcactattgtggttggtgctgcctcggctgcaaggatggaagcaaaaagggtacatcagagacatggctggtggacttagttcgttcaggaaacggtgcaattttttcaggatgcgaggctataaaagtattgcatacgagaacgaaag

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0003674 GO:0003824 GO:0005575 GO:0005622 GO:0005623 GO:0008150 GO:0008152 GO:0016491 GO:0044464 GO:0055114

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

GMC_oxred_C GMC_oxred_N

Protein Analysis

159

Amino Acids

17.37

Weight (kDa)

5.73

Isoelectric Point (pI)

39.42

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0015043)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT4G19380 AT4G19380
malus_domestica	MD16G1286200.v1.1
prunus_persica	Prupe.5G013900_v2.0.a1
rosa_chinensis	RchiOBHm_Chr7g0215241
rosa_laevigata	RLG00000002680
rosa_multiflora	Rmu_co8143572.1_g000001 Rmu_co8276433.1_g000001
rosa_roxburghii	Rroxscaffold_3G00244400
rosa_rugosa	Rorug07G0151400
rosa_samantha	Rh7AG288100 Rh7BG280000 Rh7BG280100 Rh7CG307900 Rh7DG291600
rosa_wichuraiana	Rw7G024610

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccB1I	GGYRCC	1 cut(s)	276
AccB7I	CCANNNNNTGG	2 cut(s)	217, 286
AclWI	GGATC	1 cut(s)	12
AfaI	GTAC	4 cut(s)	14, 146, 300, 382
AfiI	CCNNNNNNNGG	2 cut(s)	217, 286
AgsI	TTSAA	2 cut(s)	227, 253
AleI	CACNNNNGTG	1 cut(s)	336
Alw26I	GTCTC	1 cut(s)	383
AlwI	GGATC	1 cut(s)	12
ApeKI	GCWGC	2 cut(s)	348, 357
AspS9I	GGNCC	1 cut(s)	323
AsuHPI	GGTGA	1 cut(s)	143
AvaII	GGWCC	1 cut(s)	323
BanI	GGYRCC	1 cut(s)	276
BbvCI	CCTCAGC	1 cut(s)	123
BbvI	GCAGC	2 cut(s)	335, 344
BccI	CCATC	1 cut(s)	359
BciVI	GTATCC	1 cut(s)	303
BcoDI	GTCTC	1 cut(s)	383
BfaI	CTAG	1 cut(s)	161
BfuI	GTATCC	1 cut(s)	303
BisI	GCNGC	2 cut(s)	349, 358
BlsI	GCNGC	2 cut(s)	350, 359
Bme18I	GGWCC	1 cut(s)	323
BmgT120I	GGNCC	1 cut(s)	323
BmiI	GGNNCC	2 cut(s)	70, 278
BmsI	GCATC	1 cut(s)	431
Bpu10I	CCTNAGC	1 cut(s)	123
BsaJI	CCNNGG	3 cut(s)	154, 195, 352
BsaXI	ACNNNNNCTCC	2 cut(s)	15, 45
Bsc4I	CCNNNNNNNGG	2 cut(s)	217, 286
Bse1I	ACTGG	1 cut(s)	104
BseDI	CCNNGG	3 cut(s)	154, 195, 352
BseGI	GGATG	2 cut(s)	370, 446
BseLI	CCNNNNNNNGG	2 cut(s)	217, 286
BseMII	CTCAG	1 cut(s)	137
BseNI	ACTGG	1 cut(s)	104
BseXI	GCAGC	2 cut(s)	335, 344
BshNI	GGYRCC	1 cut(s)	276
BslI	CCNNNNNNNGG	2 cut(s)	217, 286
BsmAI	GTCTC	1 cut(s)	383
Bsp1407I	TGTACA	1 cut(s)	298
Bsp143I	GATC	1 cut(s)	4
Bsp19I	CCATGG	2 cut(s)	154, 195
BspCNI	CTCAG	1 cut(s)	136
BspLI	GGNNCC	2 cut(s)	70, 278
BspPI	GGATC	1 cut(s)	12
BspT107I	GGYRCC	1 cut(s)	276
BsrGI	TGTACA	1 cut(s)	298
BsrI	ACTGG	1 cut(s)	104
BssECI	CCNNGG	3 cut(s)	154, 195, 352
BssMI	GATC	1 cut(s)	4
BssT1I	CCWWGG	2 cut(s)	154, 195
Bst4CI	ACNGT	4 cut(s)	76, 168, 176, 425
Bst6I	CTCTTC	1 cut(s)	265
BstAUI	TGTACA	1 cut(s)	298
BstC8I	GCNNGC	1 cut(s)	67
BstDEI	CTNAG	2 cut(s)	123, 406
BstDSI	CCRYGG	2 cut(s)	154, 195
BstF5I	GGATG	2 cut(s)	370, 446
BstKTI	GATC	1 cut(s)	7
BstMAI	GTCTC	1 cut(s)	383
BstMBI	GATC	1 cut(s)	4
BstMWI	GCNNNNNNNGC	2 cut(s)	354, 357
BstNSI	RCATGY	1 cut(s)	131
BstV1I	GCAGC	2 cut(s)	335, 344
BsuI	GTATCC	1 cut(s)	303
BtgI	CCRYGG	2 cut(s)	154, 195
BtsCI	GGATG	2 cut(s)	370, 446
BtsIMutI	CAGTG	1 cut(s)	72
Cac8I	GCNNGC	1 cut(s)	67
Cfr13I	GGNCC	1 cut(s)	323
Csp6I	GTAC	4 cut(s)	13, 145, 299, 381
CviAII	CATG	5 cut(s)	128, 155, 196, 239, 393
CviJI	RGCY	8 cut(s)	69, 87, 107, 160, 194, 357, 397, 449
CviKI_1	RGCY	8 cut(s)	69, 87, 107, 160, 194, 357, 397, 449
CviQI	GTAC	4 cut(s)	13, 145, 299, 381
DdeI	CTNAG	2 cut(s)	123, 406
DpnI	GATC	1 cut(s)	6
DpnII	GATC	1 cut(s)	4
Eam1104I	CTCTTC	1 cut(s)	265
EarI	CTCTTC	1 cut(s)	265
Eco130I	CCWWGG	2 cut(s)	154, 195
Eco47I	GGWCC	1 cut(s)	323
EcoT14I	CCWWGG	2 cut(s)	154, 195
ErhI	CCWWGG	2 cut(s)	154, 195
FaeI	CATG	5 cut(s)	131, 158, 199, 242, 396
FatI	CATG	5 cut(s)	127, 154, 195, 238, 392
Fnu4HI	GCNGC	2 cut(s)	349, 358
FokI	GGATG	2 cut(s)	377, 453
Fsp4HI	GCNGC	2 cut(s)	349, 358
FspBI	CTAG	1 cut(s)	161
GluI	GCNGC	2 cut(s)	349, 358
Hin1II	CATG	5 cut(s)	131, 158, 199, 242, 396
HincII	GTYRAC	1 cut(s)	179
HindII	GTYRAC	1 cut(s)	179
HinfI	GANTC	1 cut(s)	249
HphI	GGTGA	1 cut(s)	143
Hpy166II	GTNNAC	2 cut(s)	179, 403
Hpy188I	TCNGA	2 cut(s)	232, 388
Hpy188III	TCNNGA	4 cut(s)	21, 188, 417, 438
Hpy8I	GTNNAC	2 cut(s)	179, 403
HpyAV	CCTTC	1 cut(s)	239
HpyCH4III	ACNGT	4 cut(s)	76, 168, 176, 425
HpyCH4V	TGCA	4 cut(s)	35, 360, 428, 463
HpyF10VI	GCNNNNNNNGC	2 cut(s)	354, 357
HpyF3I	CTNAG	2 cut(s)	123, 406
Hsp92II	CATG	5 cut(s)	131, 158, 199, 242, 396
Kzo9I	GATC	1 cut(s)	4
LmnI	GCTCC	1 cut(s)	74
LpnPI	CCDG	8 cut(s)	6, 51, 85, 306, 309, 383, 402, 423
Lsp1109I	GCAGC	2 cut(s)	335, 344
LweI	GCATC	1 cut(s)	431
MaeI	CTAG	1 cut(s)	161
MalI	GATC	1 cut(s)	6
MboI	GATC	1 cut(s)	4
MboII	GAAGA	2 cut(s)	254, 282
MluCI	AATT	3 cut(s)	111, 284, 429
MnlI	CCTC	8 cut(s)	17, 77, 118, 132, 266, 321, 362, 439
MslI	CAYNNNNRTG	1 cut(s)	336
MwoI	GCNNNNNNNGC	2 cut(s)	354, 357
NcoI	CCATGG	2 cut(s)	154, 195
NdeII	GATC	1 cut(s)	4
NlaIII	CATG	5 cut(s)	131, 158, 199, 242, 396
NlaIV	GGNNCC	2 cut(s)	70, 278
NmeAIII	GCCGAG	1 cut(s)	333
NspI	RCATGY	1 cut(s)	131
OliI	CACNNNNGTG	1 cut(s)	336
PfeI	GAWTC	1 cut(s)	249
PflMI	CCANNNNNTGG	2 cut(s)	217, 286
PkrI	GCNGC	2 cut(s)	350, 359
PspN4I	GGNNCC	2 cut(s)	70, 278
PspPI	GGNCC	1 cut(s)	323
RsaI	GTAC	4 cut(s)	14, 146, 300, 382
RsaNI	GTAC	4 cut(s)	13, 145, 299, 381
RseI	CAYNNNNRTG	1 cut(s)	336
SatI	GCNGC	2 cut(s)	349, 358
Sau3AI	GATC	1 cut(s)	4
Sau96I	GGNCC	1 cut(s)	323
SetI	ASST	3 cut(s)	18, 28, 124
SfaNI	GCATC	1 cut(s)	431
SinI	GGWCC	1 cut(s)	323
SmiMI	CAYNNNNRTG	1 cut(s)	336
Sse9I	AATT	3 cut(s)	111, 284, 429
SspI	AATATT	1 cut(s)	307
SspMI	CTAG	1 cut(s)	161
StyI	CCWWGG	2 cut(s)	154, 195
TaaI	ACNGT	4 cut(s)	76, 168, 176, 425
TaqI	TCGA	2 cut(s)	171, 313
TasI	AATT	3 cut(s)	111, 284, 429
TatI	WGTACW	1 cut(s)	298
TfiI	GAWTC	1 cut(s)	249
TscAI	CASTG	1 cut(s)	79
TseI	GCWGC	2 cut(s)	348, 357
TspDTI	ATGAA	1 cut(s)	255
TspRI	CASTG	1 cut(s)	79
Van91I	CCANNNNNTGG	2 cut(s)	217, 286
VpaK11BI	GGWCC	1 cut(s)	323
XceI	RCATGY	1 cut(s)	131
XspI	CTAG	1 cut(s)	161

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.