Rmu_co8155526.1_g000001

Mechanosensitive ion channel protein

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8155526.1
Physical Location & Seq
Forward (+)
1 .. 637
637 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8155526.1_g000001.1.cds

Sequence Viewer

Length: 354 bp
cttgtgattgtggcctttgtttttggtaactcatgcaagacagtctttgaagcagtcatatttctattcgtgatgcacccctttgacgtgggagatcgatgtgaaattgaaggagttcagatggttgtagaggagatgaatatcttaactacagtttttctaagtccggactcaggagatgctgttgagttctgtgtccatatagccactccagcagataagattgctgttatgaagcaaagaatgataaggtatgtgaaaagatcttatgctacttcctatattcagaatatgatgtatttcaatgtctggttaacaaatcatttcctacggttgcaattacagttacattga

Protein Analysis

117

Amino Acids

13.53

Weight (kDa)

6.05

Isoelectric Point (pI)

55.73

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0018589)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccIII TCCGGA 1 cut(s) 166
AfiI CCNNNNNNNGG 1 cut(s) 173
AgsI TTSAA 3 cut(s) 50, 110, 304
AjiI CACGTC 1 cut(s) 88
Aor13HI TCCGGA 1 cut(s) 166
AoxI GGCC 1 cut(s) 12
Asp700I GAANNNNTTC 1 cut(s) 114
BccI CCATC 1 cut(s) 115
BfmI CTRYAG 1 cut(s) 150
BglII AGATCT 1 cut(s) 263
BmgBI CACGTC 1 cut(s) 88
BmsI GCATC 2 cut(s) 63, 169
BpmI CTGGAG 1 cut(s) 195
Bsa29I ATCGAT 1 cut(s) 97
BsaBI GATNNNNATC 1 cut(s) 140
BsaWI WCCGGW 1 cut(s) 166
BsaXI ACNNNNNCTCC 2 cut(s) 168, 198
Bsc4I CCNNNNNNNGG 1 cut(s) 173
Bse8I GATNNNNATC 1 cut(s) 140
BseAI TCCGGA 1 cut(s) 166
BseCI ATCGAT 1 cut(s) 97
BseJI GATNNNNATC 1 cut(s) 140
BseLI CCNNNNNNNGG 1 cut(s) 173
BseMII CTCAG 1 cut(s) 186
BseRI GAGGAG 1 cut(s) 146
BshFI GGCC 1 cut(s) 14
BshVI ATCGAT 1 cut(s) 97
BsiSI CCGG 1 cut(s) 167
BslI CCNNNNNNNGG 1 cut(s) 173
BsnI GGCC 1 cut(s) 14
Bsp13I TCCGGA 1 cut(s) 166
Bsp143I GATC 2 cut(s) 94, 263
BspANI GGCC 1 cut(s) 14
BspCNI CTCAG 1 cut(s) 185
BspDI ATCGAT 1 cut(s) 97
BspEI TCCGGA 1 cut(s) 166
BssMI GATC 2 cut(s) 94, 263
Bst4CI ACNGT 4 cut(s) 43, 154, 333, 345
BstDEI CTNAG 2 cut(s) 161, 172
BstKTI GATC 2 cut(s) 97, 266
BstMBI GATC 2 cut(s) 94, 263
BstMWI GCNNNNNNNGC 1 cut(s) 212
BstSFI CTRYAG 1 cut(s) 150
BstX2I RGATCY 1 cut(s) 263
BstYI RGATCY 1 cut(s) 263
Bsu15I ATCGAT 1 cut(s) 97
BsuRI GGCC 1 cut(s) 14
BsuTUI ATCGAT 1 cut(s) 97
BtrI CACGTC 1 cut(s) 88
ClaI ATCGAT 1 cut(s) 97
CviAII CATG 1 cut(s) 33
CviJI RGCY 2 cut(s) 14, 206
CviKI_1 RGCY 2 cut(s) 14, 206
DdeI CTNAG 2 cut(s) 161, 172
DpnI GATC 2 cut(s) 96, 265
DpnII GATC 2 cut(s) 94, 263
FaeI CATG 1 cut(s) 36
FaiI YATR 9 cut(s) 34, 59, 201, 203, 233, 255, 270, 282, 293
FalI AAGNNNNNCTT 2 cut(s) 29, 61
FatI CATG 1 cut(s) 32
GsuI CTGGAG 1 cut(s) 195
HaeIII GGCC 1 cut(s) 14
HapII CCGG 1 cut(s) 167
Hin1II CATG 1 cut(s) 36
HincII GTYRAC 1 cut(s) 315
HindII GTYRAC 1 cut(s) 315
HinfI GANTC 1 cut(s) 170
HpaI GTTAAC 1 cut(s) 315
HpaII CCGG 1 cut(s) 167
Hpy166II GTNNAC 1 cut(s) 315
Hpy188I TCNGA 2 cut(s) 120, 288
Hpy188III TCNNGA 3 cut(s) 70, 167, 174
Hpy8I GTNNAC 1 cut(s) 315
HpyAV CCTTC 1 cut(s) 104
HpyCH4III ACNGT 4 cut(s) 43, 154, 333, 345
HpyCH4IV ACGT 1 cut(s) 87
HpyCH4V TGCA 3 cut(s) 36, 76, 337
HpyF10VI GCNNNNNNNGC 1 cut(s) 212
HpyF3I CTNAG 2 cut(s) 161, 172
HpySE526I ACGT 1 cut(s) 87
Hsp92II CATG 1 cut(s) 36
Kpn2I TCCGGA 1 cut(s) 166
KspAI GTTAAC 1 cut(s) 315
Kzo9I GATC 2 cut(s) 94, 263
LpnPI CCDG 4 cut(s) 159, 180, 225, 295
LweI GCATC 2 cut(s) 63, 169
MaeII ACGT 1 cut(s) 87
MaeIII GTNAC 2 cut(s) 26, 345
MalI GATC 2 cut(s) 96, 265
MboI GATC 2 cut(s) 94, 263
MflI RGATCY 1 cut(s) 263
MluCI AATT 2 cut(s) 105, 338
MlyI GAGTC 1 cut(s) 164
MnlI CCTC 1 cut(s) 124
MroI TCCGGA 1 cut(s) 166
MroXI GAANNNNTTC 1 cut(s) 114
MseI TTAA 2 cut(s) 146, 314
MspI CCGG 1 cut(s) 167
MwoI GCNNNNNNNGC 1 cut(s) 212
NdeII GATC 2 cut(s) 94, 263
NlaIII CATG 1 cut(s) 36
PdmI GAANNNNTTC 1 cut(s) 114
PleI GAGTC 1 cut(s) 164
PpsI GAGTC 1 cut(s) 164
PsuI RGATCY 1 cut(s) 263
SaqAI TTAA 2 cut(s) 146, 314
Sau3AI GATC 2 cut(s) 94, 263
SchI GAGTC 1 cut(s) 164
SetI ASST 2 cut(s) 90, 254
SfaNI GCATC 2 cut(s) 63, 169
SfcI CTRYAG 1 cut(s) 150
SgeI CNNG 9 cut(s) 14, 45, 49, 82, 100, 179, 186, 224, 322
Sse9I AATT 2 cut(s) 105, 338
TaaI ACNGT 4 cut(s) 43, 154, 333, 345
TaiI ACGT 1 cut(s) 90
TaqI TCGA 1 cut(s) 97
TasI AATT 2 cut(s) 105, 338
Tru1I TTAA 2 cut(s) 146, 314
Tru9I TTAA 2 cut(s) 146, 314
TspDTI ATGAA 2 cut(s) 152, 248
XmnI GAANNNNTTC 1 cut(s) 114
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.