Rmu_co8164910.1_g000001

1-acyl-sn-glycerol-3-phosphate acyltransferase

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8164910.1
Physical Location & Seq
Reverse (-)
1 .. 491
491 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8164910.1_g000001.1.cds

Sequence Viewer

Length: 380 bp
atggatgttcaaaggccttcaaataatgccatgagtgcccgtccgttaactccactgagagcaattaggggggtggtttgcttaattgtgcttgttttgactgccttcatgatgttagtgtattttggcttcatgggagctgttacagttaggattttcagcataccttacagtagaagagtaacagctgtcttctatggtgcttggatagctttatggcctgttctttttgaaaagataaacgggactaaagttatcttttctggagaaactgttcccacaggggaacgcattttgctgatttcaaatcatcgaactgaggtggactggatgtatttgtgggacttggcactgcgcaaaggacagcagggatacataaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
Pfam Domains
Protein Families

Protein Analysis

126

Amino Acids

14.34

Weight (kDa)

10.0

Isoelectric Point (pI)

33.0

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0009022)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc16I TGCGCA 1 cut(s) 356
AgsI TTSAA 4 cut(s) 11, 21, 233, 306
AloI GAACNNNNNNTCC 2 cut(s) 258, 290
AluBI AGCT 3 cut(s) 140, 188, 212
AluI AGCT 3 cut(s) 140, 188, 212
AoxI GGCC 2 cut(s) 14, 218
Asp700I GAANNNNTTC 1 cut(s) 273
AspLEI GCGC 1 cut(s) 357
BaeGI GKGCMC 1 cut(s) 40
BarI GAAGNNNNNNTAC 2 cut(s) 113, 145
BbsI GAAGAC 1 cut(s) 184
BciVI GTATCC 1 cut(s) 365
BfuI GTATCC 1 cut(s) 365
BpiI GAAGAC 1 cut(s) 184
BpmI CTGGAG 1 cut(s) 285
BsaXI ACNNNNNCTCC 2 cut(s) 258, 288
Bse1I ACTGG 1 cut(s) 332
BseGI GGATG 2 cut(s) 10, 336
BseMII CTCAG 2 cut(s) 47, 309
BseNI ACTGG 1 cut(s) 332
BseSI GKGCMC 1 cut(s) 40
BshFI GGCC 2 cut(s) 16, 220
BslFI GGGAC 2 cut(s) 259, 356
BsmFI GGGAC 2 cut(s) 259, 356
BsnI GGCC 2 cut(s) 16, 220
Bsp1286I GDGCHC 1 cut(s) 40
BspANI GGCC 2 cut(s) 16, 220
BspCNI CTCAG 2 cut(s) 48, 310
BspHI TCATGA 1 cut(s) 108
BsrI ACTGG 1 cut(s) 332
Bst4CI ACNGT 3 cut(s) 148, 173, 274
Bst6I CTCTTC 1 cut(s) 172
BstDEI CTNAG 2 cut(s) 56, 318
BstF5I GGATG 2 cut(s) 10, 336
BstHHI GCGC 1 cut(s) 357
BstMWI GCNNNNNNNGC 2 cut(s) 35, 209
BstSLI GKGCMC 1 cut(s) 40
BstV2I GAAGAC 1 cut(s) 184
BsuI GTATCC 1 cut(s) 365
BsuRI GGCC 2 cut(s) 16, 220
BtsCI GGATG 2 cut(s) 10, 336
BtsI GCAGTG 1 cut(s) 350
BtsIMutI CAGTG 2 cut(s) 53, 350
CciI TCATGA 1 cut(s) 108
CfoI GCGC 1 cut(s) 357
CviAII CATG 3 cut(s) 31, 109, 133
CviJI RGCY 6 cut(s) 16, 129, 140, 188, 212, 220
CviKI_1 RGCY 6 cut(s) 16, 129, 140, 188, 212, 220
DdeI CTNAG 2 cut(s) 56, 318
Eam1104I CTCTTC 1 cut(s) 172
EarI CTCTTC 1 cut(s) 172
Eco147I AGGCCT 1 cut(s) 16
FaeI CATG 3 cut(s) 34, 112, 136
FaiI YATR 7 cut(s) 32, 110, 134, 164, 198, 217, 377
FaqI GGGAC 2 cut(s) 259, 356
FatI CATG 3 cut(s) 30, 108, 132
FokI GGATG 2 cut(s) 17, 343
FspI TGCGCA 1 cut(s) 356
GlaI GCGC 1 cut(s) 356
GsuI CTGGAG 1 cut(s) 285
HaeIII GGCC 2 cut(s) 16, 220
HhaI GCGC 1 cut(s) 357
Hin1II CATG 3 cut(s) 34, 112, 136
Hin6I GCGC 1 cut(s) 355
HinP1I GCGC 1 cut(s) 355
HincII GTYRAC 1 cut(s) 48
HindII GTYRAC 1 cut(s) 48
HpaI GTTAAC 1 cut(s) 48
Hpy166II GTNNAC 2 cut(s) 48, 325
Hpy188III TCNNGA 2 cut(s) 109, 264
Hpy8I GTNNAC 2 cut(s) 48, 325
HpyAV CCTTC 2 cut(s) 27, 115
HpyCH4III ACNGT 3 cut(s) 148, 173, 274
HpyF10VI GCNNNNNNNGC 2 cut(s) 35, 209
HpyF3I CTNAG 2 cut(s) 56, 318
Hsp92II CATG 3 cut(s) 34, 112, 136
HspAI GCGC 1 cut(s) 355
KspAI GTTAAC 1 cut(s) 48
LmnI GCTCC 1 cut(s) 137
LpnPI CCDG 5 cut(s) 234, 249, 267, 313, 353
MaeIII GTNAC 2 cut(s) 142, 181
MboII GAAGA 2 cut(s) 184, 189
MhlI GDGCHC 1 cut(s) 40
MluCI AATT 2 cut(s) 63, 84
MnlI CCTC 1 cut(s) 313
MroXI GAANNNNTTC 1 cut(s) 273
MseI TTAA 2 cut(s) 47, 83
MspA1I CMGCKG 1 cut(s) 188
MwoI GCNNNNNNNGC 2 cut(s) 35, 209
NlaIII CATG 3 cut(s) 34, 112, 136
NsbI TGCGCA 1 cut(s) 356
PagI TCATGA 1 cut(s) 108
PceI AGGCCT 1 cut(s) 16
PdmI GAANNNNTTC 1 cut(s) 273
PvuII CAGCTG 1 cut(s) 188
SaqAI TTAA 2 cut(s) 47, 83
SduI GDGCHC 1 cut(s) 40
SetI ASST 5 cut(s) 142, 169, 190, 214, 324
Sse9I AATT 2 cut(s) 63, 84
SseBI AGGCCT 1 cut(s) 16
StuI AGGCCT 1 cut(s) 16
TaaI ACNGT 3 cut(s) 148, 173, 274
TaqI TCGA 1 cut(s) 313
TasI AATT 2 cut(s) 63, 84
Tru1I TTAA 2 cut(s) 47, 83
Tru9I TTAA 2 cut(s) 47, 83
TscAI CASTG 2 cut(s) 60, 357
TspDTI ATGAA 2 cut(s) 97, 121
TspGWI ACGGA 1 cut(s) 33
TspRI CASTG 2 cut(s) 60, 357
XmnI GAANNNNTTC 1 cut(s) 273
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.