Rmu_co8186696.1_g000001

Rho termination factor, N-terminal domain

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8186696.1
Physical Location & Seq
Forward (+)
1 .. 693
693 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8186696.1_g000001.1.cds

Sequence Viewer

Length: 476 bp
tgcagcttgttaaatttggcagacattgcagatgtgtcttcaccgtttgagaggaaggggctgaagttaacagtggcctgcgttggatctgatgaaggaagcggaagaggtcaatcttctaggagaagttcaggttcaggaagaacaaggaaaaatgatgaacctaagaaagctcgaggtgggagaaagtccaagtcatctaaccaggaagagatcatatctctgtttaggcggatacagtcttcgatctcaaaggtagactcagtagatactaagaagataaagtccaatgaatcggaagagaagccgccctcggctgagtcaattcttagggttcttcaaggtggatcaacaaagcaacgagaagaagctaaccaggaaggagaaaaggttgatatgaaagagcagcaaatacaggctaatctatcagttacagacttcaagttaacgcggccaccgtccaaattcgtgaagag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

158

Amino Acids

17.33

Weight (kDa)

9.73

Isoelectric Point (pI)

56.33

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0013074)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 258
AccII CGCG 1 cut(s) 451
AciI CCGC 4 cut(s) 102, 232, 308, 451
AclWI GGATC 2 cut(s) 94, 355
AcoI YGGCCR 1 cut(s) 452
AcsI RAATTY 2 cut(s) 13, 464
AcuI CTGAAG 1 cut(s) 83
AgsI TTSAA 2 cut(s) 341, 442
AjnI CCWGG 2 cut(s) 204, 375
AluBI AGCT 3 cut(s) 6, 173, 371
AluI AGCT 3 cut(s) 6, 173, 371
AlwI GGATC 2 cut(s) 94, 355
Ama87I CYCGRG 1 cut(s) 174
AoxI GGCC 2 cut(s) 75, 452
ApeKI GCWGC 2 cut(s) 3, 406
ApoI RAATTY 2 cut(s) 13, 464
AsuHPI GGTGA 1 cut(s) 33
AvaI CYCGRG 1 cut(s) 174
BbsI GAAGAC 2 cut(s) 30, 234
BbvI GCAGC 2 cut(s) 15, 418
BciT130I CCWGG 2 cut(s) 206, 377
BciVI GTATCC 1 cut(s) 228
BfaI CTAG 1 cut(s) 120
BfuI GTATCC 1 cut(s) 228
BisI GCNGC 4 cut(s) 4, 308, 407, 452
BlsI GCNGC 4 cut(s) 5, 309, 408, 453
Bme1390I CCNGG 2 cut(s) 206, 377
BmeT110I CYCGRG 1 cut(s) 174
BmrFI CCNGG 2 cut(s) 206, 377
BpiI GAAGAC 2 cut(s) 30, 234
BsaJI CCNNGG 1 cut(s) 312
BsaXI ACNNNNNCTCC 2 cut(s) 375, 405
Bse3DI GCAATG 1 cut(s) 24
BseBI CCWGG 2 cut(s) 206, 377
BseDI CCNNGG 1 cut(s) 312
BseMI GCAATG 1 cut(s) 24
BseMII CTCAG 2 cut(s) 276, 309
BseXI GCAGC 2 cut(s) 15, 418
Bsh1236I CGCG 1 cut(s) 451
BshFI GGCC 2 cut(s) 77, 454
BsiHKCI CYCGRG 1 cut(s) 174
BsnI GGCC 2 cut(s) 77, 454
BsoBI CYCGRG 1 cut(s) 174
Bsp143I GATC 4 cut(s) 86, 213, 246, 347
BspACI CCGC 4 cut(s) 102, 232, 308, 451
BspANI GGCC 2 cut(s) 77, 454
BspCNI CTCAG 2 cut(s) 275, 310
BspFNI CGCG 1 cut(s) 451
BspPI GGATC 2 cut(s) 94, 355
BsrDI GCAATG 1 cut(s) 24
BssECI CCNNGG 1 cut(s) 312
BssMI GATC 4 cut(s) 86, 213, 246, 347
Bst2UI CCWGG 2 cut(s) 206, 377
Bst4CI ACNGT 4 cut(s) 45, 73, 240, 459
Bst6I CTCTTC 4 cut(s) 100, 204, 294, 467
BstAPI GCANNNNNTGC 1 cut(s) 26
BstC8I GCNNGC 1 cut(s) 79
BstDEI CTNAG 5 cut(s) 165, 262, 273, 318, 329
BstFNI CGCG 1 cut(s) 451
BstKTI GATC 4 cut(s) 89, 216, 249, 350
BstMBI GATC 4 cut(s) 86, 213, 246, 347
BstMWI GCNNNNNNNGC 1 cut(s) 26
BstNI CCWGG 2 cut(s) 206, 377
BstSCI CCNGG 2 cut(s) 204, 375
BstUI CGCG 1 cut(s) 451
BstV1I GCAGC 2 cut(s) 15, 418
BstV2I GAAGAC 2 cut(s) 30, 234
BstX2I RGATCY 1 cut(s) 86
BstYI RGATCY 1 cut(s) 86
BsuI GTATCC 1 cut(s) 228
BsuRI GGCC 2 cut(s) 77, 454
BtsIMutI CAGTG 1 cut(s) 78
Cac8I GCNNGC 1 cut(s) 79
CviJI RGCY 9 cut(s) 6, 61, 77, 173, 307, 317, 371, 419, 454
CviKI_1 RGCY 9 cut(s) 6, 61, 77, 173, 307, 317, 371, 419, 454
DdeI CTNAG 5 cut(s) 165, 262, 273, 318, 329
DpnI GATC 4 cut(s) 88, 215, 248, 349
DpnII GATC 4 cut(s) 86, 213, 246, 347
EaeI YGGCCR 1 cut(s) 452
Eam1104I CTCTTC 4 cut(s) 100, 204, 294, 467
EarI CTCTTC 4 cut(s) 100, 204, 294, 467
EciI GGCGGA 1 cut(s) 247
Eco57I CTGAAG 1 cut(s) 83
Eco88I CYCGRG 1 cut(s) 174
EcoRII CCWGG 2 cut(s) 204, 375
FaiI YATR 2 cut(s) 218, 398
FblI GTMKAC 1 cut(s) 258
Fnu4HI GCNGC 4 cut(s) 4, 308, 407, 452
Fsp4HI GCNGC 4 cut(s) 4, 308, 407, 452
FspBI CTAG 1 cut(s) 120
GluI GCNGC 4 cut(s) 4, 308, 407, 452
HaeIII GGCC 2 cut(s) 77, 454
HincII GTYRAC 2 cut(s) 69, 447
HindII GTYRAC 2 cut(s) 69, 447
HinfI GANTC 3 cut(s) 260, 293, 320
HpaI GTTAAC 2 cut(s) 69, 447
HphI GGTGA 1 cut(s) 33
Hpy166II GTNNAC 3 cut(s) 69, 259, 447
Hpy188I TCNGA 2 cut(s) 91, 298
Hpy188III TCNNGA 2 cut(s) 138, 469
Hpy8I GTNNAC 3 cut(s) 69, 259, 447
HpyAV CCTTC 3 cut(s) 49, 89, 374
HpyCH4III ACNGT 4 cut(s) 45, 73, 240, 459
HpyCH4V TGCA 2 cut(s) 3, 29
HpyF10VI GCNNNNNNNGC 1 cut(s) 26
HpyF3I CTNAG 5 cut(s) 165, 262, 273, 318, 329
KspAI GTTAAC 2 cut(s) 69, 447
Kzo9I GATC 4 cut(s) 86, 213, 246, 347
LpnPI CCDG 8 cut(s) 91, 117, 123, 191, 218, 362, 389, 401
Lsp1109I GCAGC 2 cut(s) 15, 418
MaeI CTAG 1 cut(s) 120
MaeIII GTNAC 1 cut(s) 430
MalI GATC 4 cut(s) 88, 215, 248, 349
MboI GATC 4 cut(s) 86, 213, 246, 347
MflI RGATCY 1 cut(s) 86
MluCI AATT 3 cut(s) 13, 324, 464
MlyI GAGTC 2 cut(s) 254, 329
MmeI TCCRAC 1 cut(s) 64
MnlI CCTC 4 cut(s) 45, 101, 170, 322
MseI TTAA 3 cut(s) 11, 68, 446
MspR9I CCNGG 2 cut(s) 206, 377
MvaI CCWGG 2 cut(s) 206, 377
MvnI CGCG 1 cut(s) 451
MwoI GCNNNNNNNGC 1 cut(s) 26
NdeII GATC 4 cut(s) 86, 213, 246, 347
NmeAIII GCCGAG 1 cut(s) 293
PaeR7I CTCGAG 1 cut(s) 174
PcsI WCGNNNNNNNCGW 1 cut(s) 455
PfeI GAWTC 1 cut(s) 293
PkrI GCNGC 4 cut(s) 5, 309, 408, 453
PleI GAGTC 2 cut(s) 254, 328
PpsI GAGTC 2 cut(s) 254, 328
Psp6I CCWGG 2 cut(s) 204, 375
PspGI CCWGG 2 cut(s) 204, 375
PspXI VCTCGAGB 1 cut(s) 174
PsuI RGATCY 1 cut(s) 86
SaqAI TTAA 3 cut(s) 11, 68, 446
SatI GCNGC 4 cut(s) 4, 308, 407, 452
Sau3AI GATC 4 cut(s) 86, 213, 246, 347
SchI GAGTC 2 cut(s) 254, 329
ScrFI CCNGG 2 cut(s) 206, 377
Sfr274I CTCGAG 1 cut(s) 174
SlaI CTCGAG 1 cut(s) 174
SmlI CTYRAG 1 cut(s) 174
SmoI CTYRAG 1 cut(s) 174
Sse9I AATT 3 cut(s) 13, 324, 464
SsiI CCGC 4 cut(s) 102, 232, 308, 451
SspMI CTAG 1 cut(s) 120
StyD4I CCNGG 2 cut(s) 204, 375
TaaI ACNGT 4 cut(s) 45, 73, 240, 459
TaqI TCGA 2 cut(s) 175, 245
TasI AATT 3 cut(s) 13, 324, 464
TauI GCSGC 2 cut(s) 310, 454
TfiI GAWTC 1 cut(s) 293
Tru1I TTAA 3 cut(s) 11, 68, 446
Tru9I TTAA 3 cut(s) 11, 68, 446
TscAI CASTG 1 cut(s) 78
TseI GCWGC 2 cut(s) 3, 406
TspDTI ATGAA 4 cut(s) 108, 174, 306, 413
TspRI CASTG 1 cut(s) 78
XapI RAATTY 2 cut(s) 13, 464
XhoI CTCGAG 1 cut(s) 174
XmiI GTMKAC 1 cut(s) 258
XspI CTAG 1 cut(s) 120
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.