Rmu_co8197710.1_g000001

LRR receptor-like serine threonine-protein kinase

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8197710.1
Physical Location & Seq
Forward (+)
1 .. 641
641 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8197710.1_g000001.1.cds

Sequence Viewer

Length: 313 bp
tgcagactgggcacaagaaggtggtgatccatgccttccagttccatggtcttgggttgagtgtaattctgatgcacaaccaagaatcgttaaaattaaattatccagtatgaatttaacagggaatatcccttcagacttgacaaagttgagcggtttagttgagttatggcttgatgggaactcactgactggtccaatacccgatttcagtggatgtgtggacttgaagatcattcacctggagaataaccagttgtcgggtggactgccatcctctttgatggacctgccaagtttgaaggaactgtaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.

Protein Analysis

103

Amino Acids

11.1

Weight (kDa)

4.29

Isoelectric Point (pI)

29.87

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0018322)

Species Orthologous Gene IDs
arabidopsis_thaliana AT1G54730
malus_domestica MD04G1100200.v1.1
rosa_chinensis RchiOBHm_Chr3g0463431 RchiOBHm_Chr6g0293031
rosa_laevigata RLG00000014314
rosa_multiflora Rmu_co8197710.1_g000001 Rmu_sc0025580.1_g000001
rosa_rugosa Rorug01G0145000.1
rosa_samantha Rh2AG056800
rosa_wichuraiana Rw5G038540

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 298
AccBSI CCGCTC 1 cut(s) 154
AciI CCGC 1 cut(s) 154
AclWI GGATC 1 cut(s) 21
AcsI RAATTY 1 cut(s) 113
AcuI CTGAAG 1 cut(s) 118
AfiI CCNNNNNNNGG 1 cut(s) 260
AgsI TTSAA 2 cut(s) 230, 302
AjnI CCWGG 1 cut(s) 241
AlwI GGATC 1 cut(s) 21
ApoI RAATTY 1 cut(s) 113
AspS9I GGNCC 2 cut(s) 195, 287
AsuHPI GGTGA 2 cut(s) 36, 231
AvaII GGWCC 2 cut(s) 195, 287
BaeGI GKGCMC 1 cut(s) 14
BccI CCATC 3 cut(s) 171, 278, 281
BciT130I CCWGG 1 cut(s) 243
BfuAI ACCTGC 1 cut(s) 298
Bme1390I CCNGG 1 cut(s) 243
Bme18I GGWCC 2 cut(s) 195, 287
BmgT120I GGNCC 2 cut(s) 195, 287
BmrFI CCNGG 1 cut(s) 243
BmrI ACTGGG 1 cut(s) 17
BmsI GCATC 1 cut(s) 62
BmuI ACTGGG 1 cut(s) 17
BpmI CTGGAG 1 cut(s) 264
BsaJI CCNNGG 1 cut(s) 45
Bsc4I CCNNNNNNNGG 1 cut(s) 260
Bse1I ACTGG 5 cut(s) 12, 39, 106, 197, 254
BseBI CCWGG 1 cut(s) 243
BseDI CCNNGG 1 cut(s) 45
BseGI GGATG 2 cut(s) 222, 273
BseLI CCNNNNNNNGG 1 cut(s) 260
BseNI ACTGG 5 cut(s) 12, 39, 106, 197, 254
BseSI GKGCMC 1 cut(s) 14
BslI CCNNNNNNNGG 1 cut(s) 260
Bsp1286I GDGCHC 1 cut(s) 14
Bsp143I GATC 2 cut(s) 26, 232
Bsp19I CCATGG 1 cut(s) 45
BspACI CCGC 1 cut(s) 154
BspMI ACCTGC 1 cut(s) 298
BspPI GGATC 1 cut(s) 21
BsrBI CCGCTC 1 cut(s) 154
BsrI ACTGG 5 cut(s) 12, 39, 106, 197, 254
BssECI CCNNGG 1 cut(s) 45
BssMI GATC 2 cut(s) 26, 232
BssT1I CCWWGG 1 cut(s) 45
Bst2UI CCWGG 1 cut(s) 243
Bst4CI ACNGT 1 cut(s) 310
BstDSI CCRYGG 1 cut(s) 45
BstF5I GGATG 2 cut(s) 222, 273
BstKTI GATC 2 cut(s) 29, 235
BstMBI GATC 2 cut(s) 26, 232
BstMWI GCNNNNNNNGC 1 cut(s) 9
BstNI CCWGG 1 cut(s) 243
BstSCI CCNGG 1 cut(s) 241
BstSLI GKGCMC 1 cut(s) 14
BstXI CCANNNNNNTGG 2 cut(s) 46, 52
BtgI CCRYGG 1 cut(s) 45
BtsCI GGATG 2 cut(s) 222, 273
BtsIMutI CAGTG 2 cut(s) 186, 218
BveI ACCTGC 1 cut(s) 298
Cfr13I GGNCC 2 cut(s) 195, 287
CviAII CATG 2 cut(s) 31, 46
CviJI RGCY 1 cut(s) 173
CviKI_1 RGCY 1 cut(s) 173
DpnI GATC 2 cut(s) 28, 234
DpnII GATC 2 cut(s) 26, 232
Eco130I CCWWGG 1 cut(s) 45
Eco47I GGWCC 2 cut(s) 195, 287
Eco57I CTGAAG 1 cut(s) 118
EcoRII CCWGG 1 cut(s) 241
EcoT14I CCWWGG 1 cut(s) 45
ErhI CCWWGG 1 cut(s) 45
FaeI CATG 2 cut(s) 34, 49
FaiI YATR 4 cut(s) 32, 47, 111, 170
FatI CATG 2 cut(s) 30, 45
FokI GGATG 2 cut(s) 229, 260
GsuI CTGGAG 1 cut(s) 264
Hin1II CATG 2 cut(s) 34, 49
HinfI GANTC 1 cut(s) 85
HphI GGTGA 2 cut(s) 36, 231
Hpy166II GTNNAC 2 cut(s) 224, 267
Hpy188I TCNGA 2 cut(s) 71, 137
Hpy8I GTNNAC 2 cut(s) 224, 267
HpyAV CCTTC 4 cut(s) 12, 45, 142, 296
HpyCH4III ACNGT 1 cut(s) 310
HpyCH4V TGCA 2 cut(s) 3, 75
HpyF10VI GCNNNNNNNGC 1 cut(s) 9
Hsp92II CATG 2 cut(s) 34, 49
Kzo9I GATC 2 cut(s) 26, 232
LpnPI CCDG 8 cut(s) 52, 106, 119, 178, 228, 255, 267, 303
LweI GCATC 1 cut(s) 62
MalI GATC 2 cut(s) 28, 234
MbiI CCGCTC 1 cut(s) 154
MboI GATC 2 cut(s) 26, 232
MboII GAAGA 1 cut(s) 242
MhlI GDGCHC 1 cut(s) 14
MluCI AATT 4 cut(s) 65, 94, 99, 113
MnlI CCTC 1 cut(s) 287
MseI TTAA 3 cut(s) 91, 97, 117
MspR9I CCNGG 1 cut(s) 243
MvaI CCWGG 1 cut(s) 243
MwoI GCNNNNNNNGC 1 cut(s) 9
NcoI CCATGG 1 cut(s) 45
NdeII GATC 2 cut(s) 26, 232
NlaIII CATG 2 cut(s) 34, 49
PfeI GAWTC 1 cut(s) 85
Psp6I CCWGG 1 cut(s) 241
PspGI CCWGG 1 cut(s) 241
PspPI GGNCC 2 cut(s) 195, 287
SaqAI TTAA 3 cut(s) 91, 97, 117
Sau3AI GATC 2 cut(s) 26, 232
Sau96I GGNCC 2 cut(s) 195, 287
ScrFI CCNGG 1 cut(s) 243
SduI GDGCHC 1 cut(s) 14
SetI ASST 3 cut(s) 23, 244, 292
SfaNI GCATC 1 cut(s) 62
SinI GGWCC 2 cut(s) 195, 287
Sse9I AATT 4 cut(s) 65, 94, 99, 113
SsiI CCGC 1 cut(s) 154
StyD4I CCNGG 1 cut(s) 241
StyI CCWWGG 1 cut(s) 45
TaaI ACNGT 1 cut(s) 310
TasI AATT 4 cut(s) 65, 94, 99, 113
TfiI GAWTC 1 cut(s) 85
Tru1I TTAA 3 cut(s) 91, 97, 117
Tru9I TTAA 3 cut(s) 91, 97, 117
TscAI CASTG 2 cut(s) 193, 218
TspDTI ATGAA 1 cut(s) 126
TspRI CASTG 2 cut(s) 193, 218
VpaK11BI GGWCC 2 cut(s) 195, 287
XapI RAATTY 1 cut(s) 113
XcmI CCANNNNNNNNNTGG 1 cut(s) 261
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.