Rmu_sc0025580.1_g000001

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0025580.1
OG0018322
Physical Location & Seq
Reverse (-)
1 .. 2095
2095 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0025580.1_g000001.1.cds

Sequence Viewer

Length: 278 bp
atgtctcaaaattctttgagtgtttccctaccggatgaagtgggcactttagcaaatcctgctgagctagatgtatcaggaaacaagttatcaggtgagatccccattacccttggcaactgtactagcttggttagcctgcatttggaaggtaatgaattcaaaggacatattcctcaatctctagagaagttaagaggcttggatcagatggatatttctcggaataacttacctggacagattccagaatttttaggcaagcttggagctcttag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

92

Amino Acids

9.77

Weight (kDa)

4.74

Isoelectric Point (pI)

34.4

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0018322)

Species Orthologous Gene IDs
arabidopsis_thaliana AT1G54730
malus_domestica MD04G1100200.v1.1
rosa_chinensis RchiOBHm_Chr3g0463431 RchiOBHm_Chr6g0293031
rosa_laevigata RLG00000014314
rosa_multiflora Rmu_co8197710.1_g000001 Rmu_sc0025580.1_g000001
rosa_rugosa Rorug01G0145000.1
rosa_samantha Rh2AG056800
rosa_wichuraiana Rw5G038540

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 2 cut(s) 94, 213
AcsI RAATTY 3 cut(s) 10, 158, 251
AfaI GTAC 1 cut(s) 124
AfiI CCNNNNNNNGG 1 cut(s) 145
AgsI TTSAA 1 cut(s) 163
AjnI CCWGG 1 cut(s) 235
AluBI AGCT 4 cut(s) 67, 129, 265, 272
AluI AGCT 4 cut(s) 67, 129, 265, 272
Alw21I GWGCWC 1 cut(s) 274
Alw26I GTCTC 1 cut(s) 9
AlwI GGATC 2 cut(s) 94, 213
ApoI RAATTY 3 cut(s) 10, 158, 251
AsuHPI GGTGA 1 cut(s) 107
BaeGI GKGCMC 1 cut(s) 47
BanII GRGCYC 1 cut(s) 274
Bbv12I GWGCWC 1 cut(s) 274
BccI CCATC 1 cut(s) 205
BciT130I CCWGG 1 cut(s) 237
BcoDI GTCTC 1 cut(s) 9
BfaI CTAG 3 cut(s) 68, 126, 185
BlpI GCTNAGC 1 cut(s) 63
Bme1390I CCNGG 1 cut(s) 237
BmrFI CCNGG 1 cut(s) 237
Bpu1102I GCTNAGC 1 cut(s) 63
BsaJI CCNNGG 1 cut(s) 112
BsaWI WCCGGW 1 cut(s) 31
Bsc4I CCNNNNNNNGG 1 cut(s) 145
BseBI CCWGG 1 cut(s) 237
BseDI CCNNGG 1 cut(s) 112
BseGI GGATG 1 cut(s) 40
BseLI CCNNNNNNNGG 1 cut(s) 145
BseMII CTCAG 1 cut(s) 54
BseSI GKGCMC 1 cut(s) 47
BsiHKAI GWGCWC 1 cut(s) 274
BsiSI CCGG 1 cut(s) 32
BslI CCNNNNNNNGG 1 cut(s) 145
BsmAI GTCTC 1 cut(s) 9
Bsp1286I GDGCHC 2 cut(s) 47, 274
Bsp143I GATC 2 cut(s) 99, 205
Bsp1720I GCTNAGC 1 cut(s) 63
BspCNI CTCAG 1 cut(s) 55
BspPI GGATC 2 cut(s) 94, 213
BssECI CCNNGG 1 cut(s) 112
BssMI GATC 2 cut(s) 99, 205
BssT1I CCWWGG 1 cut(s) 112
Bst2UI CCWGG 1 cut(s) 237
Bst4CI ACNGT 1 cut(s) 122
BstAPI GCANNNNNTGC 1 cut(s) 59
BstC8I GCNNGC 2 cut(s) 140, 263
BstDEI CTNAG 2 cut(s) 63, 275
BstF5I GGATG 1 cut(s) 40
BstKTI GATC 2 cut(s) 102, 208
BstMAI GTCTC 1 cut(s) 9
BstMBI GATC 2 cut(s) 99, 205
BstMWI GCNNNNNNNGC 2 cut(s) 59, 135
BstNI CCWGG 1 cut(s) 237
BstSCI CCNGG 1 cut(s) 235
BstSLI GKGCMC 1 cut(s) 47
BstX2I RGATCY 1 cut(s) 99
BstYI RGATCY 1 cut(s) 99
BtsCI GGATG 1 cut(s) 40
Cac8I GCNNGC 2 cut(s) 140, 263
Csp6I GTAC 1 cut(s) 123
CviJI RGCY 6 cut(s) 67, 129, 138, 201, 265, 272
CviKI_1 RGCY 6 cut(s) 67, 129, 138, 201, 265, 272
CviQI GTAC 1 cut(s) 123
DdeI CTNAG 2 cut(s) 63, 275
DpnI GATC 2 cut(s) 101, 207
DpnII GATC 2 cut(s) 99, 205
Ecl136II GAGCTC 1 cut(s) 272
Eco130I CCWWGG 1 cut(s) 112
Eco24I GRGCYC 1 cut(s) 274
Eco53kI GAGCTC 1 cut(s) 272
EcoICRI GAGCTC 1 cut(s) 272
EcoRI GAATTC 1 cut(s) 158
EcoRII CCWGG 1 cut(s) 235
EcoT14I CCWWGG 1 cut(s) 112
EcoT38I GRGCYC 1 cut(s) 274
ErhI CCWWGG 1 cut(s) 112
FaiI YATR 1 cut(s) 171
FokI GGATG 1 cut(s) 47
FriOI GRGCYC 1 cut(s) 274
FspBI CTAG 3 cut(s) 68, 126, 185
HapII CCGG 1 cut(s) 32
HindIII AAGCTT 1 cut(s) 263
HinfI GANTC 1 cut(s) 244
HpaII CCGG 1 cut(s) 32
HphI GGTGA 1 cut(s) 107
Hpy188I TCNGA 2 cut(s) 210, 225
Hpy188III TCNNGA 3 cut(s) 78, 185, 248
HpyAV CCTTC 1 cut(s) 143
HpyCH4III ACNGT 1 cut(s) 122
HpyCH4V TGCA 1 cut(s) 142
HpyF10VI GCNNNNNNNGC 2 cut(s) 59, 135
HpyF3I CTNAG 2 cut(s) 63, 275
Kzo9I GATC 2 cut(s) 99, 205
LmnI GCTCC 1 cut(s) 269
LpnPI CCDG 8 cut(s) 45, 63, 72, 78, 152, 222, 249, 261
MaeI CTAG 3 cut(s) 68, 126, 185
MalI GATC 2 cut(s) 101, 207
MboI GATC 2 cut(s) 99, 205
MflI RGATCY 1 cut(s) 99
MhlI GDGCHC 2 cut(s) 47, 274
MluCI AATT 3 cut(s) 10, 158, 251
MnlI CCTC 2 cut(s) 186, 191
MseI TTAA 1 cut(s) 194
MspI CCGG 1 cut(s) 32
MspR9I CCNGG 1 cut(s) 237
MvaI CCWGG 1 cut(s) 237
MwoI GCNNNNNNNGC 2 cut(s) 59, 135
NdeII GATC 2 cut(s) 99, 205
PfeI GAWTC 1 cut(s) 244
Psp124BI GAGCTC 1 cut(s) 274
Psp6I CCWGG 1 cut(s) 235
PspGI CCWGG 1 cut(s) 235
PsuI RGATCY 1 cut(s) 99
RsaI GTAC 1 cut(s) 124
RsaNI GTAC 1 cut(s) 123
SacI GAGCTC 1 cut(s) 274
SaqAI TTAA 1 cut(s) 194
Sau3AI GATC 2 cut(s) 99, 205
ScrFI CCNGG 1 cut(s) 237
SduI GDGCHC 2 cut(s) 47, 274
SetI ASST 7 cut(s) 69, 97, 131, 154, 238, 267, 274
Sse9I AATT 3 cut(s) 10, 158, 251
SspMI CTAG 3 cut(s) 68, 126, 185
SstI GAGCTC 1 cut(s) 274
StyD4I CCNGG 1 cut(s) 235
StyI CCWWGG 1 cut(s) 112
TaaI ACNGT 1 cut(s) 122
TasI AATT 3 cut(s) 10, 158, 251
TatI WGTACW 1 cut(s) 122
TfiI GAWTC 1 cut(s) 244
Tru1I TTAA 1 cut(s) 194
Tru9I TTAA 1 cut(s) 194
TspDTI ATGAA 2 cut(s) 51, 171
XapI RAATTY 3 cut(s) 10, 158, 251
XbaI TCTAGA 1 cut(s) 184
XspI CTAG 3 cut(s) 68, 126, 185
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.