Rmu_co8228921.1_g000001

Elicitor-responsive protein

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8228921.1
Physical Location & Seq
Reverse (-)
1 .. 532
532 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8228921.1_g000001.1.cds

Sequence Viewer

Length: 229 bp
atggataaggacaccttcactgctgatgacaccataggcgaagcaacgatctatgttaaggagttattggaactgggtgtggagaatggatcagctgaattacatcctaagaaatatagtgtggttgctgcagataaaagtttccgtggagaaattcaagttggtgtaactttcaccaagaaggcagaacaggaatatggaggacaagaatttggaggatggaagcata
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

76

Amino Acids

8.4

Weight (kDa)

4.88

Isoelectric Point (pI)

9.52

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0012403)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 97
AcsI RAATTY 2 cut(s) 153, 209
AgsI TTSAA 1 cut(s) 158
AjuI GAANNNNNNNTTGG 2 cut(s) 144, 176
AluBI AGCT 1 cut(s) 95
AluI AGCT 1 cut(s) 95
AlwI GGATC 1 cut(s) 97
ApeKI GCWGC 1 cut(s) 128
ApoI RAATTY 2 cut(s) 153, 209
AsuHPI GGTGA 1 cut(s) 166
BbvI GCAGC 1 cut(s) 115
BccI CCATC 1 cut(s) 213
BfmI CTRYAG 1 cut(s) 129
BisI GCNGC 1 cut(s) 129
BlsI GCNGC 1 cut(s) 130
BmrI ACTGGG 1 cut(s) 83
BmuI ACTGGG 1 cut(s) 83
BsaJI CCNNGG 1 cut(s) 145
Bse1I ACTGG 1 cut(s) 78
BseDI CCNNGG 1 cut(s) 145
BseGI GGATG 2 cut(s) 103, 224
BseNI ACTGG 1 cut(s) 78
BseXI GCAGC 1 cut(s) 115
Bsp143I GATC 2 cut(s) 48, 89
BspMAI CTGCAG 1 cut(s) 133
BspPI GGATC 1 cut(s) 97
BsrI ACTGG 1 cut(s) 78
BssECI CCNNGG 1 cut(s) 145
BssMI GATC 2 cut(s) 48, 89
BstDEI CTNAG 1 cut(s) 108
BstDSI CCRYGG 1 cut(s) 145
BstF5I GGATG 2 cut(s) 103, 224
BstKTI GATC 2 cut(s) 51, 92
BstMBI GATC 2 cut(s) 48, 89
BstSFI CTRYAG 1 cut(s) 129
BstV1I GCAGC 1 cut(s) 115
BtgI CCRYGG 1 cut(s) 145
BtsCI GGATG 2 cut(s) 103, 224
BtsI GCAGTG 1 cut(s) 18
BtsIMutI CAGTG 1 cut(s) 18
CviJI RGCY 1 cut(s) 95
CviKI_1 RGCY 1 cut(s) 95
DdeI CTNAG 1 cut(s) 108
DpnI GATC 2 cut(s) 50, 91
DpnII GATC 2 cut(s) 48, 89
FaiI YATR 5 cut(s) 35, 54, 117, 198, 228
FalI AAGNNNNNCTT 1 cut(s) 31
Fnu4HI GCNGC 1 cut(s) 129
FokI GGATG 1 cut(s) 90
Fsp4HI GCNGC 1 cut(s) 129
GluI GCNGC 1 cut(s) 129
HphI GGTGA 1 cut(s) 166
HpyAV CCTTC 2 cut(s) 25, 175
HpyCH4V TGCA 1 cut(s) 131
HpyF3I CTNAG 1 cut(s) 108
Kzo9I GATC 2 cut(s) 48, 89
LpnPI CCDG 2 cut(s) 59, 176
Lsp1109I GCAGC 1 cut(s) 115
MaeIII GTNAC 1 cut(s) 166
MalI GATC 2 cut(s) 50, 91
MboI GATC 2 cut(s) 48, 89
MluCI AATT 3 cut(s) 98, 153, 209
MnlI CCTC 2 cut(s) 194, 209
MseI TTAA 1 cut(s) 57
MspA1I CMGCKG 1 cut(s) 95
NdeII GATC 2 cut(s) 48, 89
PkrI GCNGC 1 cut(s) 130
PstI CTGCAG 1 cut(s) 133
PvuII CAGCTG 1 cut(s) 95
SaqAI TTAA 1 cut(s) 57
SatI GCNGC 1 cut(s) 129
Sau3AI GATC 2 cut(s) 48, 89
SetI ASST 2 cut(s) 17, 97
SfcI CTRYAG 1 cut(s) 129
SgeI CNNG 6 cut(s) 86, 158, 170, 190, 203, 218
Sse9I AATT 3 cut(s) 98, 153, 209
TasI AATT 3 cut(s) 98, 153, 209
Tru1I TTAA 1 cut(s) 57
Tru9I TTAA 1 cut(s) 57
TscAI CASTG 1 cut(s) 25
TseI GCWGC 1 cut(s) 128
TspGWI ACGGA 1 cut(s) 134
TspRI CASTG 1 cut(s) 25
XapI RAATTY 2 cut(s) 153, 209
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.