Rmu_sc0016772.1_g000001

Elicitor-responsive protein

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0016772.1
Physical Location & Seq
Forward (+)
965 .. 2694
1730 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0016772.1_g000001.1.cds

Sequence Viewer

Length: 471 bp
atggcagttgggttgatggaagtgctgcttgtgaatgcaagaggacttggggacacagatttcgttggtcgtatggatccttatgttgcggtgaaatacaaaagccaagagcgcaggaccagcgtggccagaggacaaggtggcaatccggtgtggaatgagagattaatattcagggtagagtatccagggtccggcgagcagtataagctcacccttaaaataatggataaggacaccttcactgctgatgacaccataggcgaagcaacgatctatgttaaggagttattggaactgggtgtggagaatggatcagctgaattacatcctaagaaatatagtgtggttgctgcagataaaagtttccgtggagaaattcaagttggtgtaactttcaccaagaaggcagaacaggaatatggaggacaagaatttggaggatggaagcatagtgaatcatattcatag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

156

Amino Acids

17.37

Weight (kDa)

5.5

Isoelectric Point (pI)

16.87

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0012403)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 89
AclWI GGATC 3 cut(s) 71, 84, 322
AcoI YGGCCR 1 cut(s) 126
AcsI RAATTY 2 cut(s) 378, 434
AfiI CCNNNNNNNGG 1 cut(s) 194
AgsI TTSAA 1 cut(s) 383
AjnI CCWGG 1 cut(s) 187
AjuI GAANNNNNNNTTGG 2 cut(s) 369, 401
AluBI AGCT 2 cut(s) 211, 320
AluI AGCT 2 cut(s) 211, 320
AlwI GGATC 3 cut(s) 71, 84, 322
AoxI GGCC 1 cut(s) 126
ApeKI GCWGC 2 cut(s) 25, 353
ApoI RAATTY 2 cut(s) 378, 434
ArsI GACNNNNNNTTYG 2 cut(s) 44, 76
AseI ATTAAT 1 cut(s) 167
AspLEI GCGC 1 cut(s) 114
AspS9I GGNCC 2 cut(s) 117, 192
AsuHPI GGTGA 3 cut(s) 103, 205, 391
AvaII GGWCC 2 cut(s) 117, 192
BalI TGGCCA 1 cut(s) 128
BamHI GGATCC 1 cut(s) 76
BbvI GCAGC 2 cut(s) 12, 340
BccI CCATC 2 cut(s) 10, 438
BciT130I CCWGG 1 cut(s) 189
BciVI GTATCC 1 cut(s) 195
BfmI CTRYAG 1 cut(s) 354
BfuI GTATCC 1 cut(s) 195
BisI GCNGC 2 cut(s) 26, 354
BlsI GCNGC 2 cut(s) 27, 355
Bme1390I CCNGG 1 cut(s) 189
Bme18I GGWCC 2 cut(s) 117, 192
BmgT120I GGNCC 2 cut(s) 117, 192
BmiI GGNNCC 2 cut(s) 78, 193
BmrFI CCNGG 1 cut(s) 189
BmrI ACTGGG 1 cut(s) 308
BmuI ACTGGG 1 cut(s) 308
BsaJI CCNNGG 2 cut(s) 188, 370
BsaWI WCCGGW 1 cut(s) 148
Bsc4I CCNNNNNNNGG 1 cut(s) 194
Bse1I ACTGG 1 cut(s) 303
BseBI CCWGG 1 cut(s) 189
BseDI CCNNGG 2 cut(s) 188, 370
BseGI GGATG 2 cut(s) 328, 449
BseLI CCNNNNNNNGG 1 cut(s) 194
BseNI ACTGG 1 cut(s) 303
BseXI GCAGC 2 cut(s) 12, 340
BshFI GGCC 1 cut(s) 128
BsiSI CCGG 2 cut(s) 149, 195
BslFI GGGAC 1 cut(s) 65
BslI CCNNNNNNNGG 1 cut(s) 194
BsmFI GGGAC 1 cut(s) 65
BsmI GAATGC 1 cut(s) 40
BsnI GGCC 1 cut(s) 128
Bsp143I GATC 3 cut(s) 76, 273, 314
BspACI CCGC 1 cut(s) 89
BspANI GGCC 1 cut(s) 128
BspLI GGNNCC 2 cut(s) 78, 193
BspMAI CTGCAG 1 cut(s) 358
BspPI GGATC 3 cut(s) 71, 84, 322
BsrI ACTGG 1 cut(s) 303
BssECI CCNNGG 2 cut(s) 188, 370
BssMI GATC 3 cut(s) 76, 273, 314
Bst2UI CCWGG 1 cut(s) 189
BstC8I GCNNGC 1 cut(s) 200
BstDEI CTNAG 1 cut(s) 333
BstDSI CCRYGG 1 cut(s) 370
BstF5I GGATG 2 cut(s) 328, 449
BstHHI GCGC 1 cut(s) 114
BstKTI GATC 3 cut(s) 79, 276, 317
BstMBI GATC 3 cut(s) 76, 273, 314
BstMWI GCNNNNNNNGC 3 cut(s) 111, 120, 208
BstNI CCWGG 1 cut(s) 189
BstSCI CCNGG 1 cut(s) 187
BstSFI CTRYAG 1 cut(s) 354
BstV1I GCAGC 2 cut(s) 12, 340
BstX2I RGATCY 1 cut(s) 76
BstYI RGATCY 1 cut(s) 76
BsuI GTATCC 1 cut(s) 195
BsuRI GGCC 1 cut(s) 128
BtgI CCRYGG 1 cut(s) 370
BtsCI GGATG 2 cut(s) 328, 449
BtsI GCAGTG 1 cut(s) 243
BtsIMutI CAGTG 1 cut(s) 243
Cac8I GCNNGC 1 cut(s) 200
CfoI GCGC 1 cut(s) 114
Cfr13I GGNCC 2 cut(s) 117, 192
CviJI RGCY 4 cut(s) 105, 128, 211, 320
CviKI_1 RGCY 4 cut(s) 105, 128, 211, 320
DdeI CTNAG 1 cut(s) 333
DpnI GATC 3 cut(s) 78, 275, 316
DpnII GATC 3 cut(s) 76, 273, 314
EaeI YGGCCR 1 cut(s) 126
Eco47I GGWCC 2 cut(s) 117, 192
EcoRII CCWGG 1 cut(s) 187
FalI AAGNNNNNCTT 4 cut(s) 12, 44, 224, 256
FaqI GGGAC 1 cut(s) 65
Fnu4HI GCNGC 2 cut(s) 26, 354
FokI GGATG 2 cut(s) 315, 456
Fsp4HI GCNGC 2 cut(s) 26, 354
GlaI GCGC 1 cut(s) 113
GluI GCNGC 2 cut(s) 26, 354
HaeIII GGCC 1 cut(s) 128
HapII CCGG 2 cut(s) 149, 195
HhaI GCGC 1 cut(s) 114
Hin6I GCGC 1 cut(s) 112
HinP1I GCGC 1 cut(s) 112
HinfI GANTC 1 cut(s) 458
HpaII CCGG 2 cut(s) 149, 195
HphI GGTGA 3 cut(s) 103, 205, 391
HpyAV CCTTC 2 cut(s) 250, 400
HpyCH4V TGCA 2 cut(s) 38, 356
HpyF10VI GCNNNNNNNGC 3 cut(s) 111, 120, 208
HpyF3I CTNAG 1 cut(s) 333
HspAI GCGC 1 cut(s) 112
Kzo9I GATC 3 cut(s) 76, 273, 314
Lsp1109I GCAGC 2 cut(s) 12, 340
MaeIII GTNAC 1 cut(s) 391
MalI GATC 3 cut(s) 78, 275, 316
MboI GATC 3 cut(s) 76, 273, 314
MflI RGATCY 1 cut(s) 76
MlsI TGGCCA 1 cut(s) 128
MluCI AATT 3 cut(s) 323, 378, 434
MluNI TGGCCA 1 cut(s) 128
MnlI CCTC 4 cut(s) 35, 125, 419, 434
Mox20I TGGCCA 1 cut(s) 128
MscI TGGCCA 1 cut(s) 128
MseI TTAA 3 cut(s) 167, 219, 282
Msp20I TGGCCA 1 cut(s) 128
MspA1I CMGCKG 1 cut(s) 320
MspI CCGG 2 cut(s) 149, 195
MspR9I CCNGG 1 cut(s) 189
Mva1269I GAATGC 1 cut(s) 40
MvaI CCWGG 1 cut(s) 189
MwoI GCNNNNNNNGC 3 cut(s) 111, 120, 208
NdeII GATC 3 cut(s) 76, 273, 314
NlaIV GGNNCC 2 cut(s) 78, 193
PctI GAATGC 1 cut(s) 40
PfeI GAWTC 1 cut(s) 458
PkrI GCNGC 2 cut(s) 27, 355
PshBI ATTAAT 1 cut(s) 167
Psp6I CCWGG 1 cut(s) 187
PspGI CCWGG 1 cut(s) 187
PspN4I GGNNCC 2 cut(s) 78, 193
PspPI GGNCC 2 cut(s) 117, 192
PstI CTGCAG 1 cut(s) 358
PsuI RGATCY 1 cut(s) 76
PvuII CAGCTG 1 cut(s) 320
SaqAI TTAA 3 cut(s) 167, 219, 282
SatI GCNGC 2 cut(s) 26, 354
Sau3AI GATC 3 cut(s) 76, 273, 314
Sau96I GGNCC 2 cut(s) 117, 192
ScrFI CCNGG 1 cut(s) 189
SetI ASST 4 cut(s) 142, 213, 242, 322
SfcI CTRYAG 1 cut(s) 354
SinI GGWCC 2 cut(s) 117, 192
Sse9I AATT 3 cut(s) 323, 378, 434
SsiI CCGC 1 cut(s) 89
SspI AATATT 1 cut(s) 171
StyD4I CCNGG 1 cut(s) 187
TasI AATT 3 cut(s) 323, 378, 434
TfiI GAWTC 1 cut(s) 458
Tru1I TTAA 3 cut(s) 167, 219, 282
Tru9I TTAA 3 cut(s) 167, 219, 282
TscAI CASTG 1 cut(s) 250
TseI GCWGC 2 cut(s) 25, 353
TspDTI ATGAA 1 cut(s) 456
TspGWI ACGGA 1 cut(s) 359
TspRI CASTG 1 cut(s) 250
VpaK11BI GGWCC 2 cut(s) 117, 192
VspI ATTAAT 1 cut(s) 167
XapI RAATTY 2 cut(s) 378, 434
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.