Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_co8238381.1

Orthogroup ID

OG0008220

Physical Location & Seq

Genomic Coordinates Reverse (-)

1 .. 701

Gene Structure 701 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_co8238381.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 405 bp

atggttccaccaccacctcctccaagacaacaacctccagtgcctggacccaccctgattccaaatatacatcctgatgtgttacccccaggtatctctcgttttcctccaccgccacctccaccagatatgcggccaccattatccgctcctggacttcccagtcgaccaggtccaccaggcatgatggtcccaatgattcccaggccaccatatggacctccccctggacctcctccaatgatgagaccaccacttccacctggcccccctcctacatttcaagaagatgaccatgcagcctatggcgtggctgctcatcataaaccatcatatattaaatcggcagcatctactgttgttaagaggcctctagctcagcacactccagaacttacagccatg

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

ko03040 ko04062 ko04144 ko04520 ko04530 ko04666 ko04810 ko05100 ko05130 ko05131 ko05132 ko05231 map03040 map04062 map04144 map04520 map04530 map04666 map04810 map05100 map05130 map05131 map05132 map05231

Pfam Domains

Protein Families

NpwBP Wbp11

Protein Analysis

135

Amino Acids

14.25

Weight (kDa)

9.98

Isoelectric Point (pI)

77.51

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0008220)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT5G62640 AT5G62640 AT5G62640
fragaria_vesca	FvH4_5g15820 FvH4_5g15820
malus_domestica	MD06G1185300.v1.1 MD14G1191200.v1.1
prunus_persica	Prupe.5G184200_v2.0.a1 Prupe.5G184200_v2.0.a1
pyrus_communis	pycom06g16480 pycom14g15930
rosa_chinensis	RchiOBHm_Chr7g0180271 RchiOBHm_Chr7g0180311
rosa_laevigata	RLG00000005278
rosa_multiflora	Rmu_co8238381.1_g000001 Rmu_ssc0000099.1_g000001
rosa_roxburghii	Rroxscaffold_3G00273000
rosa_rugosa	Rorug06G0431900
rosa_samantha	Rh7AG032500 Rh7CG034300 Rh7DG032700 Rh7DG033000
rosa_wichuraiana	Rw7G002700

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AasI	GACNNNNNNGTC	1 cut(s)	162
AccB7I	CCANNNNNTGG	2 cut(s)	44, 215
AccBSI	CCGCTC	1 cut(s)	149
AccI	GTMKAC	1 cut(s)	166
AciI	CCGC	3 cut(s)	113, 133, 147
AcoI	YGGCCR	1 cut(s)	134
AfiI	CCNNNNNNNGG	3 cut(s)	44, 215, 227
AgsI	TTSAA	1 cut(s)	284
AjnI	CCWGG	8 cut(s)	43, 88, 151, 169, 178, 203, 226, 262
AluBI	AGCT	1 cut(s)	377
AluI	AGCT	1 cut(s)	377
Alw26I	GTCTC	1 cut(s)	241
AlwNI	CAGNNNCTG	1 cut(s)	44
AoxI	GGCC	4 cut(s)	134, 206, 265, 368
ApeKI	GCWGC	3 cut(s)	299, 314, 347
AspS9I	GGNCC	6 cut(s)	47, 173, 190, 218, 230, 266
AvaII	GGWCC	5 cut(s)	47, 173, 190, 218, 230
BbvI	GCAGC	3 cut(s)	301, 311, 359
BccI	CCATC	2 cut(s)	181, 337
BciT130I	CCWGG	8 cut(s)	45, 90, 153, 171, 180, 205, 228, 264
BcoDI	GTCTC	1 cut(s)	241
BfaI	CTAG	1 cut(s)	374
BisI	GCNGC	4 cut(s)	134, 300, 315, 348
BlpI	GCTNAGC	1 cut(s)	378
BlsI	GCNGC	4 cut(s)	135, 301, 316, 349
Bme1390I	CCNGG	8 cut(s)	45, 90, 153, 171, 180, 205, 228, 264
Bme18I	GGWCC	5 cut(s)	47, 173, 190, 218, 230
BmgT120I	GGNCC	6 cut(s)	47, 173, 190, 218, 230, 266
BmiI	GGNNCC	4 cut(s)	6, 49, 192, 268
BmrFI	CCNGG	8 cut(s)	45, 90, 153, 171, 180, 205, 228, 264
BmrI	ACTGGG	1 cut(s)	156
BmsI	GCATC	1 cut(s)	359
BmuI	ACTGGG	1 cut(s)	156
BpmI	CTGGAG	2 cut(s)	21, 372
Bpu1102I	GCTNAGC	1 cut(s)	378
BsaI	GGTCTC	1 cut(s)	241
BsaJI	CCNNGG	3 cut(s)	88, 203, 226
Bsc4I	CCNNNNNNNGG	3 cut(s)	44, 215, 227
Bse1I	ACTGG	2 cut(s)	38, 162
BseBI	CCWGG	8 cut(s)	45, 90, 153, 171, 180, 205, 228, 264
BseDI	CCNNGG	3 cut(s)	88, 203, 226
BseGI	GGATG	1 cut(s)	70
BseLI	CCNNNNNNNGG	3 cut(s)	44, 215, 227
BseMII	CTCAG	1 cut(s)	392
BseNI	ACTGG	2 cut(s)	38, 162
BseRI	GAGGAG	2 cut(s)	9, 225
BseXI	GCAGC	3 cut(s)	301, 311, 359
BshFI	GGCC	4 cut(s)	136, 208, 267, 370
BslFI	GGGAC	1 cut(s)	176
BslI	CCNNNNNNNGG	3 cut(s)	44, 215, 227
BsmAI	GTCTC	1 cut(s)	241
BsmFI	GGGAC	1 cut(s)	176
BsnI	GGCC	4 cut(s)	136, 208, 267, 370
Bso31I	GGTCTC	1 cut(s)	241
Bsp1720I	GCTNAGC	1 cut(s)	378
BspACI	CCGC	3 cut(s)	113, 133, 147
BspANI	GGCC	4 cut(s)	136, 208, 267, 370
BspCNI	CTCAG	1 cut(s)	391
BspLI	GGNNCC	4 cut(s)	6, 49, 192, 268
BspTNI	GGTCTC	1 cut(s)	241
BsrBI	CCGCTC	1 cut(s)	149
BsrI	ACTGG	2 cut(s)	38, 162
BssECI	CCNNGG	3 cut(s)	88, 203, 226
Bst2UI	CCWGG	8 cut(s)	45, 90, 153, 171, 180, 205, 228, 264
Bst4CI	ACNGT	1 cut(s)	358
BstDEI	CTNAG	1 cut(s)	378
BstF5I	GGATG	1 cut(s)	70
BstMAI	GTCTC	1 cut(s)	241
BstNI	CCWGG	8 cut(s)	45, 90, 153, 171, 180, 205, 228, 264
BstSCI	CCNGG	8 cut(s)	43, 88, 151, 169, 178, 203, 226, 262
BstV1I	GCAGC	3 cut(s)	301, 311, 359
BsuRI	GGCC	4 cut(s)	136, 208, 267, 370
BtsCI	GGATG	1 cut(s)	70
BtsIMutI	CAGTG	1 cut(s)	45
CaiI	CAGNNNCTG	1 cut(s)	44
Cfr13I	GGNCC	6 cut(s)	47, 173, 190, 218, 230, 266
CsiI	ACCWGGT	1 cut(s)	169
CviAII	CATG	3 cut(s)	184, 296, 403
CviJI	RGCY	8 cut(s)	136, 208, 267, 302, 314, 370, 377, 401
CviKI_1	RGCY	8 cut(s)	136, 208, 267, 302, 314, 370, 377, 401
DdeI	CTNAG	1 cut(s)	378
DrdI	GACNNNNNNGTC	1 cut(s)	162
DseDI	GACNNNNNNGTC	1 cut(s)	162
EaeI	YGGCCR	1 cut(s)	134
Eco147I	AGGCCT	1 cut(s)	370
Eco31I	GGTCTC	1 cut(s)	241
Eco47I	GGWCC	5 cut(s)	47, 173, 190, 218, 230
EcoRII	CCWGG	8 cut(s)	43, 88, 151, 169, 178, 203, 226, 262
FaeI	CATG	2 cut(s)	187, 299
FaqI	GGGAC	1 cut(s)	176
FatI	CATG	2 cut(s)	183, 295
FauNDI	CATATG	1 cut(s)	214
FblI	GTMKAC	1 cut(s)	166
Fnu4HI	GCNGC	4 cut(s)	134, 300, 315, 348
FokI	GGATG	1 cut(s)	57
Fsp4HI	GCNGC	4 cut(s)	134, 300, 315, 348
FspBI	CTAG	1 cut(s)	374
GluI	GCNGC	4 cut(s)	134, 300, 315, 348
GsuI	CTGGAG	2 cut(s)	21, 372
HaeIII	GGCC	4 cut(s)	136, 208, 267, 370
Hin1II	CATG	2 cut(s)	187, 299
HincII	GTYRAC	1 cut(s)	167
HindII	GTYRAC	1 cut(s)	167
HinfI	GANTC	2 cut(s)	58, 199
Hpy166II	GTNNAC	2 cut(s)	167, 176
Hpy188III	TCNNGA	3 cut(s)	74, 284, 389
Hpy8I	GTNNAC	2 cut(s)	167, 176
HpyCH4III	ACNGT	1 cut(s)	358
HpyCH4V	TGCA	1 cut(s)	299
HpyF3I	CTNAG	1 cut(s)	378
Hsp92II	CATG	2 cut(s)	187, 299
LmnI	GCTCC	1 cut(s)	154
Lsp1109I	GCAGC	3 cut(s)	301, 311, 359
LweI	GCATC	1 cut(s)	359
MabI	ACCWGGT	1 cut(s)	169
MaeI	CTAG	1 cut(s)	374
MaeIII	GTNAC	1 cut(s)	81
MbiI	CCGCTC	1 cut(s)	149
MboII	GAAGA	1 cut(s)	299
MseI	TTAA	2 cut(s)	339, 363
MslI	CAYNNNNRTG	1 cut(s)	75
MspR9I	CCNGG	8 cut(s)	45, 90, 153, 171, 180, 205, 228, 264
MvaI	CCWGG	8 cut(s)	45, 90, 153, 171, 180, 205, 228, 264
NdeI	CATATG	1 cut(s)	214
NlaIII	CATG	2 cut(s)	187, 299
NlaIV	GGNNCC	4 cut(s)	6, 49, 192, 268
PceI	AGGCCT	1 cut(s)	370
PfeI	GAWTC	2 cut(s)	58, 199
PflFI	GACNNNGTC	1 cut(s)	171
PflMI	CCANNNNNTGG	2 cut(s)	44, 215
PfoI	TCCNGGA	1 cut(s)	151
PkrI	GCNGC	4 cut(s)	135, 301, 316, 349
Psp6I	CCWGG	8 cut(s)	43, 88, 151, 169, 178, 203, 226, 262
PspGI	CCWGG	8 cut(s)	43, 88, 151, 169, 178, 203, 226, 262
PspN4I	GGNNCC	4 cut(s)	6, 49, 192, 268
PspPI	GGNCC	6 cut(s)	47, 173, 190, 218, 230, 266
PstNI	CAGNNNCTG	1 cut(s)	44
PsyI	GACNNNGTC	1 cut(s)	171
RseI	CAYNNNNRTG	1 cut(s)	75
SalI	GTCGAC	1 cut(s)	165
SaqAI	TTAA	2 cut(s)	339, 363
SatI	GCNGC	4 cut(s)	134, 300, 315, 348
Sau96I	GGNCC	6 cut(s)	47, 173, 190, 218, 230, 266
ScrFI	CCNGG	8 cut(s)	45, 90, 153, 171, 180, 205, 228, 264
SetI	ASST	9 cut(s)	19, 37, 94, 121, 175, 223, 235, 265, 379
SexAI	ACCWGGT	1 cut(s)	169
SfaNI	GCATC	1 cut(s)	359
SinI	GGWCC	5 cut(s)	47, 173, 190, 218, 230
SmiMI	CAYNNNNRTG	1 cut(s)	75
SseBI	AGGCCT	1 cut(s)	370
SsiI	CCGC	3 cut(s)	113, 133, 147
SspMI	CTAG	1 cut(s)	374
StuI	AGGCCT	1 cut(s)	370
StyD4I	CCNGG	8 cut(s)	43, 88, 151, 169, 178, 203, 226, 262
TaaI	ACNGT	1 cut(s)	358
TaqI	TCGA	1 cut(s)	166
TauI	GCSGC	1 cut(s)	136
TfiI	GAWTC	2 cut(s)	58, 199
Tru1I	TTAA	2 cut(s)	339, 363
Tru9I	TTAA	2 cut(s)	339, 363
TscAI	CASTG	1 cut(s)	45
TseI	GCWGC	3 cut(s)	299, 314, 347
TspRI	CASTG	1 cut(s)	45
Tth111I	GACNNNGTC	1 cut(s)	171
Van91I	CCANNNNNTGG	2 cut(s)	44, 215
VpaK11BI	GGWCC	5 cut(s)	47, 173, 190, 218, 230
XcmI	CCANNNNNNNNNTGG	1 cut(s)	302
XmiI	GTMKAC	1 cut(s)	166
XspI	CTAG	1 cut(s)	374

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.