Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_co8283243.1

Orthogroup ID

OG0014343

Physical Location & Seq

Genomic Coordinates Reverse (-)

247 .. 825

Gene Structure 579 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_co8283243.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 579 bp

atggcagttctgagtgcttgcagccatgctggactcgtcgatgaaggcttgaggtatttcaaatcaatgataaatgattataaggttactccagataaggacatatatggttgcgtggtggatttgctgtgccgtgctgggagaatcaaggaagcttatgagttaatagagagcatgccatttaagcctgatgagtctgtttggggtgcgcttcttggagcgtgcagagcacataagcttccacatttgagcagactagctgctcagaggatattagatttgaggccaaacatggcgggaacatatgtgatgctgtcaaatttttatgccgctgaaggtaagtggggggaatttgccaatatgagaatgttgatgagaggaatggggaataagaaagaggcaggacagagttggattgaggtaagagatcaggtttatagttttgttgtaggagataagatgggttctcatataaagtgggtgtatggagttttggaattactgatttggcatatgaaagaggcagagtacttaactgatttggattgctctgtacatgaccaagatgagggaacttga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0000959 GO:0001101 GO:0003674 GO:0003676 GO:0003723 GO:0003824 GO:0004518 GO:0004519 GO:0005488 GO:0005575 GO:0005622 GO:0005623 GO:0005737 GO:0005739 GO:0006139 GO:0006725 GO:0006807 GO:0006950 GO:0006952 GO:0006970 GO:0008150 GO:0008152 GO:0009451 GO:0009605 GO:0009607 GO:0009620 GO:0009628 GO:0009651 GO:0009719 GO:0009725 GO:0009737 GO:0009743 GO:0009746 GO:0009749 GO:0009987 GO:0010033 GO:0016070 GO:0016071 GO:0016556 GO:0016787 GO:0016788 GO:0033993 GO:0034284 GO:0034641 GO:0042221 GO:0043170 GO:0043207 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0043412 GO:0044237 GO:0044238 GO:0044424 GO:0044444 GO:0044464 GO:0046483 GO:0050832 GO:0050896 GO:0051704 GO:0051707 GO:0071704 GO:0080156 GO:0090304 GO:0090305 GO:0097159 GO:0097305 GO:0098542 GO:1900864 GO:1901360 GO:1901363 GO:1901700

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

DYW_deaminase PPR PPR_2

Protein Analysis

192

Amino Acids

21.75

Weight (kDa)

5.87

Isoelectric Point (pI)

27.51

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0014343)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT1G56570 AT1G56570
fragaria_vesca	FvH4_6g07860
prunus_persica	Prupe.6G310000_v2.0.a1
pyrus_communis	pycom04g16900
rosa_chinensis	RchiOBHm_Chr3g0457561
rosa_laevigata	RLG00000025210
rosa_multiflora	Rmu_co8283243.1_g000001 Rmu_sc0007404.1_g000004 Rmu_sc0035246.1_g000001
rosa_roxburghii	Rroxscaffold_6G00421730
rosa_rugosa	Rorug03G0021400
rosa_samantha	Rh3AG082000 Rh3BG084200 Rh3CG084400 Rh3DG085700
rosa_wichuraiana	Rw3G007040

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AanI	TTATAA	1 cut(s)	81
AciI	CCGC	2 cut(s)	296, 330
AcsI	RAATTY	2 cut(s)	319, 350
AcuI	CTGAAG	1 cut(s)	354
AfaI	GTAC	2 cut(s)	530, 555
AfiI	CCNNNNNNNGG	1 cut(s)	568
AgsI	TTSAA	1 cut(s)	61
AluBI	AGCT	3 cut(s)	155, 238, 260
AluI	AGCT	3 cut(s)	155, 238, 260
Alw21I	GWGCWC	1 cut(s)	232
AoxI	GGCC	1 cut(s)	284
ApeKI	GCWGC	2 cut(s)	21, 260
ApoI	RAATTY	2 cut(s)	319, 350
AspLEI	GCGC	1 cut(s)	211
Bbv12I	GWGCWC	1 cut(s)	232
BbvI	GCAGC	2 cut(s)	33, 247
BccI	CCATC	1 cut(s)	454
BceAI	ACGGC	1 cut(s)	117
BfaI	CTAG	1 cut(s)	257
BisI	GCNGC	3 cut(s)	22, 261, 330
BlsI	GCNGC	3 cut(s)	23, 262, 331
BmcAI	AGTACT	1 cut(s)	530
BmsI	GCATC	1 cut(s)	300
BpmI	CTGGAG	1 cut(s)	75
BpuEI	CTTGAG	1 cut(s)	70
Bsc4I	CCNNNNNNNGG	1 cut(s)	568
BseLI	CCNNNNNNNGG	1 cut(s)	568
BseMII	CTCAG	1 cut(s)	278
BseXI	GCAGC	2 cut(s)	33, 247
BseYI	CCCAGC	1 cut(s)	137
BsgI	GTGCAG	1 cut(s)	244
BshFI	GGCC	1 cut(s)	286
BsiHKAI	GWGCWC	1 cut(s)	232
BslI	CCNNNNNNNGG	1 cut(s)	568
BsnI	GGCC	1 cut(s)	286
Bsp1286I	GDGCHC	1 cut(s)	232
Bsp1407I	TGTACA	1 cut(s)	553
Bsp143I	GATC	1 cut(s)	427
BspACI	CCGC	2 cut(s)	296, 330
BspANI	GGCC	1 cut(s)	286
BspCNI	CTCAG	1 cut(s)	277
BsrGI	TGTACA	1 cut(s)	553
BssMI	GATC	1 cut(s)	427
BstAUI	TGTACA	1 cut(s)	553
BstC8I	GCNNGC	3 cut(s)	19, 176, 223
BstDEI	CTNAG	2 cut(s)	11, 264
BstHHI	GCGC	1 cut(s)	211
BstKTI	GATC	1 cut(s)	430
BstMBI	GATC	1 cut(s)	427
BstMWI	GCNNNNNNNGC	2 cut(s)	184, 227
BstNSI	RCATGY	1 cut(s)	178
BstV1I	GCAGC	2 cut(s)	33, 247
BsuRI	GGCC	1 cut(s)	286
Cac8I	GCNNGC	3 cut(s)	19, 176, 223
CfoI	GCGC	1 cut(s)	211
Csp6I	GTAC	2 cut(s)	529, 554
CviAII	CATG	4 cut(s)	26, 175, 292, 557
CviJI	RGCY	7 cut(s)	24, 48, 155, 187, 238, 260, 286
CviKI_1	RGCY	7 cut(s)	24, 48, 155, 187, 238, 260, 286
CviQI	GTAC	2 cut(s)	529, 554
DdeI	CTNAG	2 cut(s)	11, 264
DpnI	GATC	1 cut(s)	429
DpnII	GATC	1 cut(s)	427
Eco57I	CTGAAG	1 cut(s)	354
FaeI	CATG	4 cut(s)	29, 178, 295, 560
FatI	CATG	4 cut(s)	25, 174, 291, 556
FauI	CCCGC	1 cut(s)	289
FauNDI	CATATG	2 cut(s)	304, 513
Fnu4HI	GCNGC	3 cut(s)	22, 261, 330
Fsp4HI	GCNGC	3 cut(s)	22, 261, 330
FspBI	CTAG	1 cut(s)	257
GlaI	GCGC	1 cut(s)	210
GluI	GCNGC	3 cut(s)	22, 261, 330
GsaI	CCCAGC	1 cut(s)	141
GsuI	CTGGAG	1 cut(s)	75
HaeIII	GGCC	1 cut(s)	286
HhaI	GCGC	1 cut(s)	211
Hin1II	CATG	4 cut(s)	29, 178, 295, 560
Hin6I	GCGC	1 cut(s)	209
HinP1I	GCGC	1 cut(s)	209
HindIII	AAGCTT	2 cut(s)	153, 236
HinfI	GANTC	3 cut(s)	33, 144, 194
Hpy188I	TCNGA	2 cut(s)	12, 267
Hpy188III	TCNNGA	1 cut(s)	92
Hpy99I	CGWCG	1 cut(s)	41
HpyAV	CCTTC	2 cut(s)	38, 329
HpyCH4V	TGCA	2 cut(s)	21, 225
HpyF10VI	GCNNNNNNNGC	2 cut(s)	184, 227
HpyF3I	CTNAG	2 cut(s)	11, 264
Hsp92II	CATG	4 cut(s)	29, 178, 295, 560
HspAI	GCGC	1 cut(s)	209
Kzo9I	GATC	1 cut(s)	427
LmnI	GCTCC	1 cut(s)	218
LpnPI	CCDG	6 cut(s)	15, 105, 123, 201, 387, 416
Lsp1109I	GCAGC	2 cut(s)	33, 247
LweI	GCATC	1 cut(s)	300
MaeI	CTAG	1 cut(s)	257
MaeIII	GTNAC	1 cut(s)	85
MalI	GATC	1 cut(s)	429
MboI	GATC	1 cut(s)	427
MhlI	GDGCHC	1 cut(s)	232
MluCI	AATT	3 cut(s)	319, 350, 497
MlyI	GAGTC	2 cut(s)	27, 203
MmeI	TCCRAC	1 cut(s)	392
MnlI	CCTC	8 cut(s)	45, 261, 276, 371, 391, 412, 514, 562
MseI	TTAA	3 cut(s)	164, 183, 533
MspA1I	CMGCKG	1 cut(s)	332
MwoI	GCNNNNNNNGC	2 cut(s)	184, 227
NdeI	CATATG	2 cut(s)	304, 513
NdeII	GATC	1 cut(s)	427
NlaIII	CATG	4 cut(s)	29, 178, 295, 560
NspI	RCATGY	1 cut(s)	178
PaeI	GCATGC	1 cut(s)	178
PfeI	GAWTC	1 cut(s)	144
PkrI	GCNGC	3 cut(s)	23, 262, 331
PleI	GAGTC	2 cut(s)	27, 202
PpsI	GAGTC	2 cut(s)	27, 202
PsiI	TTATAA	1 cut(s)	81
PspFI	CCCAGC	1 cut(s)	137
RsaI	GTAC	2 cut(s)	530, 555
RsaNI	GTAC	2 cut(s)	529, 554
SaqAI	TTAA	3 cut(s)	164, 183, 533
SatI	GCNGC	3 cut(s)	22, 261, 330
Sau3AI	GATC	1 cut(s)	427
ScaI	AGTACT	1 cut(s)	530
SchI	GAGTC	2 cut(s)	27, 203
SduI	GDGCHC	1 cut(s)	232
SetI	ASST	8 cut(s)	56, 87, 157, 240, 262, 340, 423, 435
SfaNI	GCATC	1 cut(s)	300
SmlI	CTYRAG	1 cut(s)	49
SmoI	CTYRAG	1 cut(s)	49
SphI	GCATGC	1 cut(s)	178
Sse9I	AATT	3 cut(s)	319, 350, 497
SsiI	CCGC	2 cut(s)	296, 330
SspMI	CTAG	1 cut(s)	257
TaqI	TCGA	1 cut(s)	39
TasI	AATT	3 cut(s)	319, 350, 497
TatI	WGTACW	2 cut(s)	528, 553
TauI	GCSGC	1 cut(s)	332
TfiI	GAWTC	1 cut(s)	144
Tru1I	TTAA	3 cut(s)	164, 183, 533
Tru9I	TTAA	3 cut(s)	164, 183, 533
TseI	GCWGC	2 cut(s)	21, 260
TspDTI	ATGAA	2 cut(s)	57, 530
XapI	RAATTY	2 cut(s)	319, 350
XceI	RCATGY	1 cut(s)	178
XspI	CTAG	1 cut(s)	257
ZrmI	AGTACT	1 cut(s)	530

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.