Rmu_co8286829.1_g000001

Uncharacterized ACR, COG1399

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8286829.1
Physical Location & Seq
Forward (+)
1 .. 697
697 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8286829.1_g000001.1.cds

Sequence Viewer

Length: 201 bp
gtgatctatgtgaagcctggaaatgaagcggaacttgattcactggtacaagactcaatacggctcgccacctccataaaggatacttgttcagagctatgtgaaaaatcttatccaactgtgcagtatattggtggagagagcagggcttctattgataaaaggtggtctagactcctggagctcaagaatttgctgtaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

66

Amino Acids

7.44

Weight (kDa)

5.28

Isoelectric Point (pI)

36.35

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 29
AcsI RAATTY 1 cut(s) 190
AfaI GTAC 1 cut(s) 48
AjnI CCWGG 2 cut(s) 16, 177
AluBI AGCT 2 cut(s) 97, 184
AluI AGCT 2 cut(s) 97, 184
Alw21I GWGCWC 1 cut(s) 186
ApoI RAATTY 1 cut(s) 190
BanII GRGCYC 1 cut(s) 186
Bbv12I GWGCWC 1 cut(s) 186
BceAI ACGGC 1 cut(s) 77
BciT130I CCWGG 2 cut(s) 18, 179
BciVI GTATCC 1 cut(s) 76
BfaI CTAG 1 cut(s) 171
BfuI GTATCC 1 cut(s) 76
Bme1390I CCNGG 2 cut(s) 18, 179
BmrFI CCNGG 2 cut(s) 18, 179
BpmI CTGGAG 1 cut(s) 200
BpuEI CTTGAG 1 cut(s) 170
Bse1I ACTGG 1 cut(s) 48
BseBI CCWGG 2 cut(s) 18, 179
BseNI ACTGG 1 cut(s) 48
BsgI GTGCAG 1 cut(s) 143
BsiHKAI GWGCWC 1 cut(s) 186
Bsp1286I GDGCHC 1 cut(s) 186
Bsp143I GATC 1 cut(s) 3
BspACI CCGC 1 cut(s) 29
BsrI ACTGG 1 cut(s) 48
BssMI GATC 1 cut(s) 3
Bst2UI CCWGG 2 cut(s) 18, 179
Bst4CI ACNGT 1 cut(s) 121
BstC8I GCNNGC 1 cut(s) 66
BstKTI GATC 1 cut(s) 6
BstMBI GATC 1 cut(s) 3
BstNI CCWGG 2 cut(s) 18, 179
BstSCI CCNGG 2 cut(s) 16, 177
BsuI GTATCC 1 cut(s) 76
BtsIMutI CAGTG 1 cut(s) 41
Cac8I GCNNGC 1 cut(s) 66
Csp6I GTAC 1 cut(s) 47
CviJI RGCY 5 cut(s) 16, 64, 97, 149, 184
CviKI_1 RGCY 5 cut(s) 16, 64, 97, 149, 184
CviQI GTAC 1 cut(s) 47
DpnI GATC 1 cut(s) 5
DpnII GATC 1 cut(s) 3
Ecl136II GAGCTC 1 cut(s) 184
Eco24I GRGCYC 1 cut(s) 186
Eco53kI GAGCTC 1 cut(s) 184
EcoICRI GAGCTC 1 cut(s) 184
EcoRII CCWGG 2 cut(s) 16, 177
EcoT38I GRGCYC 1 cut(s) 186
FaiI YATR 4 cut(s) 9, 77, 100, 129
FalI AAGNNNNNCTT 2 cut(s) 18, 50
FriOI GRGCYC 1 cut(s) 186
FspBI CTAG 1 cut(s) 171
GsuI CTGGAG 1 cut(s) 200
HinfI GANTC 3 cut(s) 38, 53, 174
Hpy188I TCNGA 1 cut(s) 94
Hpy188III TCNNGA 2 cut(s) 171, 187
HpyCH4III ACNGT 1 cut(s) 121
HpyCH4V TGCA 1 cut(s) 124
Kzo9I GATC 1 cut(s) 3
LmnI GCTCC 1 cut(s) 181
LpnPI CCDG 6 cut(s) 3, 29, 30, 130, 164, 191
MaeI CTAG 1 cut(s) 171
MalI GATC 1 cut(s) 5
MboI GATC 1 cut(s) 3
MhlI GDGCHC 1 cut(s) 186
MluCI AATT 1 cut(s) 190
MlyI GAGTC 2 cut(s) 47, 168
MmeI TCCRAC 1 cut(s) 140
MnlI CCTC 1 cut(s) 82
MspR9I CCNGG 2 cut(s) 18, 179
MvaI CCWGG 2 cut(s) 18, 179
NdeII GATC 1 cut(s) 3
PfeI GAWTC 1 cut(s) 38
PfoI TCCNGGA 1 cut(s) 177
PleI GAGTC 2 cut(s) 47, 168
PpsI GAGTC 2 cut(s) 47, 168
Psp124BI GAGCTC 1 cut(s) 186
Psp6I CCWGG 2 cut(s) 16, 177
PspGI CCWGG 2 cut(s) 16, 177
RsaI GTAC 1 cut(s) 48
RsaNI GTAC 1 cut(s) 47
SacI GAGCTC 1 cut(s) 186
Sau3AI GATC 1 cut(s) 3
SchI GAGTC 2 cut(s) 47, 168
ScrFI CCNGG 2 cut(s) 18, 179
SduI GDGCHC 1 cut(s) 186
SetI ASST 4 cut(s) 74, 99, 167, 186
SmlI CTYRAG 1 cut(s) 185
SmoI CTYRAG 1 cut(s) 185
Sse9I AATT 1 cut(s) 190
SsiI CCGC 1 cut(s) 29
SspMI CTAG 1 cut(s) 171
SstI GAGCTC 1 cut(s) 186
StyD4I CCNGG 2 cut(s) 16, 177
TaaI ACNGT 1 cut(s) 121
TasI AATT 1 cut(s) 190
TfiI GAWTC 1 cut(s) 38
TscAI CASTG 1 cut(s) 48
TspDTI ATGAA 1 cut(s) 39
TspRI CASTG 1 cut(s) 48
XapI RAATTY 1 cut(s) 190
XbaI TCTAGA 1 cut(s) 170
XspI CTAG 1 cut(s) 171
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.